Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001083.1

Orthogroup ID

OG0007506

Physical Location & Seq

Genomic Coordinates Reverse (-)

60709 .. 63772

Gene Structure 3064 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001083.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1461 bp

atgtcctgcttccccaaaaatccgactctttcttcacctatacaattttctcaacaaagggttgttagttttaatacagttatatgctgtgcaagccccagggatactattgaacattctggtaatgggtttggtggtcttcctgaaaaactgtactctcatagagaatcaggtactagtagtagtactagtactaacaaagttgcacctccaaggcctcgccggatcattttggttcggcatgggcagagtgaaggaaatgtggacgagagcgtttacactagagtttctgatccaaagatccgattgaccgagaaaggtatggctgatgctgaggaatgcgggaagaggatcagggagatgattgaaaaagacaaagtgcatgattggaaggtctacttctatgtgtctccttatagaagaacagttgaaacactcaaggggttagggaaagcatttgagcgctcaagaattgctggcatgagagaagaacctcgcctaagagagcaagattttgttatatgctgtgcaagccccagggatactattgaacattctggtaatgggtttggtggtcttcctgaaaaactgtactctcatagagaatcaggtactagtagtagtactagtactaacaaagttgcacctccaaggcctcgccggatcattttggttcggcatgggcagagtgaaggaaatgtggacgagagcgtttacactagagtttctgatccaaagatccgattgaccgagaaaggtatggctgatgctgaggaatgcgggaagaggatcagggagatgattgaaaaagacaaagtgcatgattggaaggtctacttctatgtgtctccttatagaagaacagttgaaacactcaaggggttagggaaagcatttgagcgctcaagaattgctggcatgagagaagaacctcgcctaagagagcaagattttggtaagtgcattccatatagggatagggagaagatgagacttgataaagctatgcgtatgctttacggtcgattcttttaccggtttcctaatggggaatctgcagctgatgtttatgataggattacaggattcagagaaacattgaaatcggatattgatgtgggaaggtttcagccaccaggggagagaaattcaaacatcaacttggtgatagtttcgcatggcctaacgctgagagtgtttctgatgagatggtacaagtggacagtggagcagtttgatggcctcaacaactttggtaatggaagcatggttgttatggaaagaggctacggtggaaggtacagcttgtcaatacaccacacagaagaagagctaagagagtttggattctcgaacgaaatgatagttgatcaggaatggcaaaaatatgcaagaattggagagctgaactatgattgtccaacgctaaactccttcacccactttggtgaagatgattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

His_Phos_1

Protein Analysis

486

Amino Acids

56.01

Weight (kDa)

8.95

Isoelectric Point (pI)

44.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007506)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g02940
malus_domestica	MD06G1088600.v1.1 MD14G1109700.v1.1
prunus_persica	Prupe.5G104500_v2.0.a1 Prupe.5G104500_v2.0.a1
pyrus_communis	pycom06g08450 pycom14g10380
rosa_chinensis	RchiOBHm_Chr7g0196931 RchiOBHm_Chr7g0196941
rosa_laevigata	RLG00000003978 RLG00000003979
rosa_multiflora	Rmu_sc0001083.1_g000007 Rmu_sc0001083.1_g000008
rosa_roxburghii	Rroxscaffold_3G00258820
rosa_rugosa	Rorug07G0036800
rosa_samantha	Rh7AG161200 Rh7AG161300 Rh7BG163300 Rh7BG163400 Rh7CG169400 Rh7CG169500 Rh7DG162700 Rh7DG162800
rosa_wichuraiana	Rw7G014100 Rw7G014110

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	2 cut(s)	396, 834
AciI	CCGC	2 cut(s)	342, 780
AclWI	GGATC	8 cut(s)	233, 287, 295, 359, 671, 725, 733, 797
AcsI	RAATTY	1 cut(s)	1147
AfeI	AGCGCT	2 cut(s)	464, 902
AgeI	ACCGGT	1 cut(s)	1035
AgsI	TTSAA	8 cut(s)	113, 368, 431, 551, 806, 869, 1102, 1152
AhlI	ACTAGT	4 cut(s)	176, 188, 614, 626
AjnI	CCWGG	3 cut(s)	98, 536, 1135
AleI	CACNNNNGTG	1 cut(s)	1446
AluBI	AGCT	5 cut(s)	1004, 1061, 1305, 1333, 1405
AluI	AGCT	5 cut(s)	1004, 1061, 1305, 1333, 1405
Alw26I	GTCTC	3 cut(s)	414, 852, 985
AlwI	GGATC	8 cut(s)	233, 287, 295, 359, 671, 725, 733, 797
Aor51HI	AGCGCT	2 cut(s)	464, 902
AoxI	GGCC	4 cut(s)	215, 653, 1180, 1240
ApeKI	GCWGC	1 cut(s)	1058
ApoI	RAATTY	1 cut(s)	1147
AsiGI	ACCGGT	1 cut(s)	1035
AspLEI	GCGC	2 cut(s)	465, 903
AsuHPI	GGTGA	4 cut(s)	27, 1177, 1429, 1460
BbsI	GAAGAC	2 cut(s)	131, 569
BbvCI	CCTCAGC	2 cut(s)	333, 771
BbvI	GCAGC	1 cut(s)	1070
BccI	CCATC	2 cut(s)	1203, 1232
BciT130I	CCWGG	3 cut(s)	100, 538, 1137
BciVI	GTATCC	2 cut(s)	97, 535
BclI	TGATCA	1 cut(s)	1369
BcoDI	GTCTC	3 cut(s)	414, 852, 985
BcuI	ACTAGT	4 cut(s)	176, 188, 614, 626
BfaI	CTAG	6 cut(s)	177, 189, 282, 615, 627, 720
BfmI	CTRYAG	1 cut(s)	1056
BfoI	RGCGCY	2 cut(s)	466, 904
BfuI	GTATCC	2 cut(s)	97, 535
BisI	GCNGC	1 cut(s)	1059
BlsI	GCNGC	1 cut(s)	1060
BmcAI	AGTACT	4 cut(s)	187, 193, 625, 631
Bme1390I	CCNGG	3 cut(s)	100, 538, 1137
BmrFI	CCNGG	3 cut(s)	100, 538, 1137
BmsI	GCATC	2 cut(s)	319, 757
BpiI	GAAGAC	2 cut(s)	131, 569
Bpu10I	CCTNAGC	2 cut(s)	333, 771
BpuEI	CTTGAG	4 cut(s)	422, 451, 860, 889
BsaJI	CCNNGG	7 cut(s)	98, 99, 212, 536, 537, 650, 1136
BsaWI	WCCGGW	1 cut(s)	1035
Bse118I	RCCGGY	1 cut(s)	1035
BseBI	CCWGG	3 cut(s)	100, 538, 1137
BseDI	CCNNGG	7 cut(s)	98, 99, 212, 536, 537, 650, 1136
BseMII	CTCAG	3 cut(s)	324, 762, 1181
BseXI	GCAGC	1 cut(s)	1070
Bsh1285I	CGRYCG	1 cut(s)	1024
BshFI	GGCC	4 cut(s)	217, 655, 1182, 1242
BshTI	ACCGGT	1 cut(s)	1035
BsiEI	CGRYCG	1 cut(s)	1024
BsiSI	CCGG	3 cut(s)	223, 661, 1036
BsmAI	GTCTC	3 cut(s)	414, 852, 985
BsmI	GAATGC	3 cut(s)	344, 782, 963
BsnI	GGCC	4 cut(s)	217, 655, 1182, 1242
Bsp143I	GATC	9 cut(s)	225, 292, 300, 351, 663, 730, 738, 789, 1369
BspACI	CCGC	2 cut(s)	342, 780
BspANI	GGCC	4 cut(s)	217, 655, 1182, 1242
BspCNI	CTCAG	3 cut(s)	325, 763, 1182
BspMAI	CTGCAG	1 cut(s)	1060
BspPI	GGATC	8 cut(s)	233, 287, 295, 359, 671, 725, 733, 797
BspQI	GCTCTTC	1 cut(s)	1323
BsrFI	RCCGGY	1 cut(s)	1035
BssAI	RCCGGY	1 cut(s)	1035
BssECI	CCNNGG	7 cut(s)	98, 99, 212, 536, 537, 650, 1136
BssMI	GATC	9 cut(s)	225, 292, 300, 351, 663, 730, 738, 789, 1369
BssT1I	CCWWGG	2 cut(s)	212, 650
Bst2UI	CCWGG	3 cut(s)	100, 538, 1137
Bst4CI	ACNGT	8 cut(s)	79, 153, 427, 591, 865, 1022, 1225, 1292
Bst6I	CTCTTC	3 cut(s)	341, 779, 1323
BstC8I	GCNNGC	4 cut(s)	94, 478, 532, 916
BstDEI	CTNAG	6 cut(s)	333, 500, 771, 938, 1190, 1334
BstH2I	RGCGCY	2 cut(s)	466, 904
BstHHI	GCGC	2 cut(s)	465, 903
BstKTI	GATC	9 cut(s)	228, 295, 303, 354, 666, 733, 741, 792, 1372
BstMAI	GTCTC	3 cut(s)	414, 852, 985
BstMBI	GATC	9 cut(s)	225, 292, 300, 351, 663, 730, 738, 789, 1369
BstMCI	CGRYCG	1 cut(s)	1024
BstMWI	GCNNNNNNNGC	2 cut(s)	93, 531
BstNI	CCWGG	3 cut(s)	100, 538, 1137
BstSCI	CCNGG	3 cut(s)	98, 536, 1135
BstSFI	CTRYAG	1 cut(s)	1056
BstV1I	GCAGC	1 cut(s)	1070
BstV2I	GAAGAC	2 cut(s)	131, 569
BstX2I	RGATCY	2 cut(s)	300, 738
BstYI	RGATCY	2 cut(s)	300, 738
BsuI	GTATCC	2 cut(s)	97, 535
BsuRI	GGCC	4 cut(s)	217, 655, 1182, 1242
BtsIMutI	CAGTG	1 cut(s)	1230
Cac8I	GCNNGC	4 cut(s)	94, 478, 532, 916
CfoI	GCGC	2 cut(s)	465, 903
Cfr10I	RCCGGY	1 cut(s)	1035
CspAI	ACCGGT	1 cut(s)	1035
CviAII	CATG	8 cut(s)	242, 383, 481, 680, 821, 919, 1178, 1267
DdeI	CTNAG	6 cut(s)	333, 500, 771, 938, 1190, 1334
DpnI	GATC	9 cut(s)	227, 294, 302, 353, 665, 732, 740, 791, 1371
DpnII	GATC	9 cut(s)	225, 292, 300, 351, 663, 730, 738, 789, 1369
Eam1104I	CTCTTC	3 cut(s)	341, 779, 1323
EarI	CTCTTC	3 cut(s)	341, 779, 1323
Eco130I	CCWWGG	2 cut(s)	212, 650
Eco147I	AGGCCT	2 cut(s)	217, 655
Eco47III	AGCGCT	2 cut(s)	464, 902
EcoRII	CCWGG	3 cut(s)	98, 536, 1135
EcoT14I	CCWWGG	2 cut(s)	212, 650
ErhI	CCWWGG	2 cut(s)	212, 650
FaeI	CATG	8 cut(s)	245, 386, 484, 683, 824, 922, 1181, 1270
FalI	AAGNNNNNCTT	4 cut(s)	383, 415, 821, 853
FatI	CATG	8 cut(s)	241, 382, 480, 679, 820, 918, 1177, 1266
FauI	CCCGC	2 cut(s)	335, 773
FbaI	TGATCA	1 cut(s)	1369
FblI	GTMKAC	2 cut(s)	396, 834
Fnu4HI	GCNGC	1 cut(s)	1059
Fsp4HI	GCNGC	1 cut(s)	1059
FspBI	CTAG	6 cut(s)	177, 189, 282, 615, 627, 720
GlaI	GCGC	2 cut(s)	464, 902
GluI	GCNGC	1 cut(s)	1059
HaeII	RGCGCY	2 cut(s)	466, 904
HaeIII	GGCC	4 cut(s)	217, 655, 1182, 1242
HapII	CCGG	3 cut(s)	223, 661, 1036
HhaI	GCGC	2 cut(s)	465, 903
Hin1II	CATG	8 cut(s)	245, 386, 484, 683, 824, 922, 1181, 1270
Hin6I	GCGC	2 cut(s)	463, 901
HinP1I	GCGC	2 cut(s)	463, 901
HinfI	GANTC	7 cut(s)	25, 167, 605, 1026, 1052, 1086, 1347
HpaII	CCGG	3 cut(s)	223, 661, 1036
HphI	GGTGA	4 cut(s)	27, 1177, 1429, 1460
Hpy166II	GTNNAC	7 cut(s)	265, 277, 397, 703, 715, 835, 1221
Hpy188I	TCNGA	8 cut(s)	24, 292, 305, 730, 743, 1091, 1108, 1203
Hpy188III	TCNNGA	6 cut(s)	143, 468, 581, 906, 1351, 1373
Hpy8I	GTNNAC	7 cut(s)	265, 277, 397, 703, 715, 835, 1221
HpyAV	CCTTC	7 cut(s)	248, 385, 686, 823, 1116, 1290, 1444
HpyCH4III	ACNGT	8 cut(s)	79, 153, 427, 591, 865, 1022, 1225, 1292
HpyCH4V	TGCA	9 cut(s)	92, 206, 382, 530, 644, 820, 963, 1058, 1391
HpyF10VI	GCNNNNNNNGC	2 cut(s)	93, 531
HpyF3I	CTNAG	6 cut(s)	333, 500, 771, 938, 1190, 1334
Hsp92II	CATG	8 cut(s)	245, 386, 484, 683, 824, 922, 1181, 1270
HspAI	GCGC	2 cut(s)	463, 901
Ksp22I	TGATCA	1 cut(s)	1369
Kzo9I	GATC	9 cut(s)	225, 292, 300, 351, 663, 730, 738, 789, 1369
LguI	GCTCTTC	1 cut(s)	1323
LmnI	GCTCC	1 cut(s)	1228
Lsp1109I	GCAGC	1 cut(s)	1070
LweI	GCATC	2 cut(s)	319, 757
MaeI	CTAG	6 cut(s)	177, 189, 282, 615, 627, 720
MalI	GATC	9 cut(s)	227, 294, 302, 353, 665, 732, 740, 791, 1371
MboI	GATC	9 cut(s)	225, 292, 300, 351, 663, 730, 738, 789, 1369
MflI	RGATCY	2 cut(s)	300, 738
MluCI	AATT	5 cut(s)	44, 471, 909, 1147, 1395
MlyI	GAGTC	1 cut(s)	19
MmeI	TCCRAC	2 cut(s)	47, 1445
MseI	TTAA	1 cut(s)	72
MslI	CAYNNNNRTG	1 cut(s)	1446
MspA1I	CMGCKG	1 cut(s)	1061
MspI	CCGG	3 cut(s)	223, 661, 1036
MspR9I	CCNGG	3 cut(s)	100, 538, 1137
Mva1269I	GAATGC	3 cut(s)	344, 782, 963
MvaI	CCWGG	3 cut(s)	100, 538, 1137
MwoI	GCNNNNNNNGC	2 cut(s)	93, 531
NdeII	GATC	9 cut(s)	225, 292, 300, 351, 663, 730, 738, 789, 1369
NlaIII	CATG	8 cut(s)	245, 386, 484, 683, 824, 922, 1181, 1270
OliI	CACNNNNGTG	1 cut(s)	1446
PasI	CCCWGGG	2 cut(s)	99, 537
PceI	AGGCCT	2 cut(s)	217, 655
PciSI	GCTCTTC	1 cut(s)	1323
PctI	GAATGC	3 cut(s)	344, 782, 963
PfeI	GAWTC	6 cut(s)	167, 605, 1026, 1052, 1086, 1347
PinAI	ACCGGT	1 cut(s)	1035
PkrI	GCNGC	1 cut(s)	1060
PleI	GAGTC	1 cut(s)	19
PpsI	GAGTC	1 cut(s)	19
Psp6I	CCWGG	3 cut(s)	98, 536, 1135
PspGI	CCWGG	3 cut(s)	98, 536, 1135
PstI	CTGCAG	1 cut(s)	1060
PsuI	RGATCY	2 cut(s)	300, 738
PvuII	CAGCTG	1 cut(s)	1061
RseI	CAYNNNNRTG	1 cut(s)	1446
SapI	GCTCTTC	1 cut(s)	1323
SaqAI	TTAA	1 cut(s)	72
SatI	GCNGC	1 cut(s)	1059
Sau3AI	GATC	9 cut(s)	225, 292, 300, 351, 663, 730, 738, 789, 1369
ScaI	AGTACT	4 cut(s)	187, 193, 625, 631
SchI	GAGTC	1 cut(s)	19
ScrFI	CCNGG	3 cut(s)	100, 538, 1137
SfaNI	GCATC	2 cut(s)	319, 757
SfcI	CTRYAG	1 cut(s)	1056
SmiMI	CAYNNNNRTG	1 cut(s)	1446
SmlI	CTYRAG	4 cut(s)	437, 466, 875, 904
SmoI	CTYRAG	4 cut(s)	437, 466, 875, 904
SpeI	ACTAGT	4 cut(s)	176, 188, 614, 626
Sse9I	AATT	5 cut(s)	44, 471, 909, 1147, 1395
SseBI	AGGCCT	2 cut(s)	217, 655
SsiI	CCGC	2 cut(s)	342, 780
SspMI	CTAG	6 cut(s)	177, 189, 282, 615, 627, 720
StuI	AGGCCT	2 cut(s)	217, 655
StyD4I	CCNGG	3 cut(s)	98, 536, 1135
StyI	CCWWGG	2 cut(s)	212, 650
TaaI	ACNGT	8 cut(s)	79, 153, 427, 591, 865, 1022, 1225, 1292
TaqI	TCGA	2 cut(s)	1024, 1352
TaqII	GACCGA	2 cut(s)	326, 764
TasI	AATT	5 cut(s)	44, 471, 909, 1147, 1395
TatI	WGTACW	6 cut(s)	153, 185, 191, 591, 623, 629
TfiI	GAWTC	6 cut(s)	167, 605, 1026, 1052, 1086, 1347
Tru1I	TTAA	1 cut(s)	72
Tru9I	TTAA	1 cut(s)	72
TscAI	CASTG	1 cut(s)	1230
TseI	GCWGC	1 cut(s)	1058
TspRI	CASTG	1 cut(s)	1230
XapI	RAATTY	1 cut(s)	1147
XmiI	GTMKAC	2 cut(s)	396, 834
XspI	CTAG	6 cut(s)	177, 189, 282, 615, 627, 720
ZrmI	AGTACT	4 cut(s)	187, 193, 625, 631

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.