Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001226.1

Orthogroup ID

OG0007198

Physical Location & Seq

Genomic Coordinates Forward (+)

28266 .. 31413

Gene Structure 3148 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001226.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 969 bp

ctgattcggttccttggtataatggaaactcagaggagaacttttgggttgtgctattccttgtcagtgggggttttcttggtattcttctctggcattggttcttctgcagtttcagatgaggtaaaaaggtgtgatccacactctaatgatagtgactcaagtattagttgtagctccaagaactatgttttgcagtcttactatgaaaaatatgaagacctactagattcaaatttccaagattttatagcacaagaacttcctattggtttgtgtgaggtgctgccacataatctgagtcttgctttaagactctccattttgcatcgcaatctgatagggaatggttcttatcgtcatcttacgtcgtcctttagacttaagattgaacaagaatccatacttgagcttccttctcaccactgtgaggtcatagtcattgagagactgccatctggggtatttgctgatccatttgagcttcaacatctccttcagcatggtgtgtacggcaatatagctgtctttggagatacaaatttggaattgccttcttttctttccaatcgttctgctgtagaggttcacatggatgttggtcatgatctcttgctgggtccgagtaaagagtctaccatcaatttagagcttcccctacatgcacgatatccacctctagatgaaagtggctattgggaagtcaaatttggtacacctgatttcttcatgcgttgcagtgttgagggaaagtcacataatcaaagctgtgtttataggataccagatattgatggttctgattcaacatttggtacaattgtctggaacataccttctgggatgaaggcacatgctcgaattgtttctgtcttcacttttattgctgccttaatttcagccatcttgattgctgtaacatccatattttattcagacaactccagcaaacgttcaaaggaatcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00563 ko01100 map00563 map01100

Pfam Domains

Protein Families

PIG-X

Protein Analysis

322

Amino Acids

35.95

Weight (kDa)

5.5

Isoelectric Point (pI)

45.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007198)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G46850 AT5G46850 AT5G46850
fragaria_vesca	FvH4_5g22760
malus_domestica	MD06G1038100.v1.1
prunus_persica	Prupe.5G030700_v2.0.a1 Prupe.5G030700_v2.0.a1
pyrus_communis	pycom06g03180
rosa_chinensis	RchiOBHm_Chr7g0211361
rosa_laevigata	RLG00000003006
rosa_multiflora	Rmu_sc0001226.1_g000005 Rmu_sc0002283.1_g000060 Rmu_sc0005514.1_g000015 Rmu_sc0019867.1_g000001
rosa_roxburghii	Rroxscaffold_2G00115290 Rroxscaffold_3G00247900
rosa_rugosa	Rorug07G0125300
rosa_samantha	Rh2CG320500 Rh7AG257800 Rh7BG251900 Rh7CG274300 Rh7DG264000 Rh7DG271700
rosa_wichuraiana	Rw7G022030 Rw7G022650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	635
AclI	AACGTT	1 cut(s)	952
AclWI	GGATC	2 cut(s)	131, 467
AcsI	RAATTY	3 cut(s)	235, 541, 707
AcuI	CTGAAG	1 cut(s)	482
AfaI	GTAC	3 cut(s)	512, 715, 817
AfiI	CCNNNNNNNGG	1 cut(s)	430
AflII	CTTAAG	1 cut(s)	383
AgsI	TTSAA	5 cut(s)	234, 392, 488, 807, 957
AjuI	GAANNNNNNNTTGG	4 cut(s)	252, 284, 693, 725
AleI	CACNNNNGTG	1 cut(s)	426
AluBI	AGCT	6 cut(s)	177, 412, 484, 524, 652, 768
AluI	AGCT	6 cut(s)	177, 412, 484, 524, 652, 768
Alw26I	GTCTC	1 cut(s)	442
AlwI	GGATC	2 cut(s)	131, 467
ApeKI	GCWGC	2 cut(s)	286, 887
ApoI	RAATTY	3 cut(s)	235, 541, 707
Asp700I	GAANNNNTTC	1 cut(s)	865
AspS9I	GGNCC	1 cut(s)	620
AsuHPI	GGTGA	1 cut(s)	413
AvaII	GGWCC	1 cut(s)	620
BaeI	ACNNNNGTAYC	2 cut(s)	807, 840
BbsI	GAAGAC	2 cut(s)	225, 865
BbvI	GCAGC	2 cut(s)	273, 874
BccI	CCATC	4 cut(s)	463, 647, 788, 911
BceAI	ACGGC	1 cut(s)	529
BciVI	GTATCC	1 cut(s)	774
BcoDI	GTCTC	1 cut(s)	442
BfaI	CTAG	2 cut(s)	227, 680
BfmI	CTRYAG	2 cut(s)	108, 579
BfrI	CTTAAG	1 cut(s)	383
BfuI	GTATCC	1 cut(s)	774
BisI	GCNGC	2 cut(s)	287, 888
BlsI	GCNGC	2 cut(s)	288, 889
Bme18I	GGWCC	1 cut(s)	620
BmgT120I	GGNCC	1 cut(s)	620
BmiI	GGNNCC	2 cut(s)	11, 621
BmsI	GCATC	1 cut(s)	337
BpiI	GAAGAC	2 cut(s)	225, 865
BpmI	CTGGAG	1 cut(s)	928
BpuEI	CTTGAG	2 cut(s)	145, 428
BsaJI	CCNNGG	1 cut(s)	13
Bsc4I	CCNNNNNNNGG	1 cut(s)	430
BseDI	CCNNGG	1 cut(s)	13
BseGI	GGATG	3 cut(s)	601, 849, 920
BseLI	CCNNNNNNNGG	1 cut(s)	430
BseMII	CTCAG	2 cut(s)	44, 290
BseRI	GAGGAG	1 cut(s)	49
BseXI	GCAGC	2 cut(s)	273, 874
BseYI	CCCAGC	1 cut(s)	616
BslI	CCNNNNNNNGG	1 cut(s)	430
BsmAI	GTCTC	1 cut(s)	442
Bsp143I	GATC	3 cut(s)	136, 472, 607
BspCNI	CTCAG	2 cut(s)	43, 291
BspHI	TCATGA	1 cut(s)	604
BspLI	GGNNCC	2 cut(s)	11, 621
BspMAI	CTGCAG	1 cut(s)	112
BspPI	GGATC	2 cut(s)	131, 467
BspTI	CTTAAG	1 cut(s)	383
BssECI	CCNNGG	1 cut(s)	13
BssMI	GATC	3 cut(s)	136, 472, 607
BssT1I	CCWWGG	1 cut(s)	13
Bst4CI	ACNGT	1 cut(s)	428
BstAFI	CTTAAG	1 cut(s)	383
BstDEI	CTNAG	3 cut(s)	30, 299, 966
BstF5I	GGATG	3 cut(s)	601, 849, 920
BstKTI	GATC	3 cut(s)	139, 475, 610
BstMAI	GTCTC	1 cut(s)	442
BstMBI	GATC	3 cut(s)	136, 472, 607
BstNSI	RCATGY	2 cut(s)	665, 857
BstSFI	CTRYAG	2 cut(s)	108, 579
BstV1I	GCAGC	2 cut(s)	273, 874
BstV2I	GAAGAC	2 cut(s)	225, 865
BsuI	GTATCC	1 cut(s)	774
BtgZI	GCGATG	1 cut(s)	314
BtsCI	GGATG	3 cut(s)	601, 849, 920
BtsI	GCAGTG	1 cut(s)	745
BtsIMutI	CAGTG	3 cut(s)	72, 424, 745
CciI	TCATGA	1 cut(s)	604
Cfr13I	GGNCC	1 cut(s)	620
Csp6I	GTAC	3 cut(s)	511, 714, 816
CviAII	CATG	6 cut(s)	503, 592, 605, 662, 730, 854
CviJI	RGCY	8 cut(s)	177, 412, 484, 524, 652, 693, 768, 902
CviKI_1	RGCY	8 cut(s)	177, 412, 484, 524, 652, 693, 768, 902
CviQI	GTAC	3 cut(s)	511, 714, 816
DdeI	CTNAG	3 cut(s)	30, 299, 966
DpnI	GATC	3 cut(s)	138, 474, 609
DpnII	GATC	3 cut(s)	136, 472, 607
Eco130I	CCWWGG	1 cut(s)	13
Eco32I	GATATC	1 cut(s)	671
Eco47I	GGWCC	1 cut(s)	620
Eco57I	CTGAAG	1 cut(s)	482
EcoRV	GATATC	1 cut(s)	671
EcoT14I	CCWWGG	1 cut(s)	13
ErhI	CCWWGG	1 cut(s)	13
FaeI	CATG	6 cut(s)	506, 595, 608, 665, 733, 857
FatI	CATG	6 cut(s)	502, 591, 604, 661, 729, 853
FblI	GTMKAC	1 cut(s)	635
Fnu4HI	GCNGC	2 cut(s)	287, 888
FokI	GGATG	3 cut(s)	608, 856, 907
Fsp4HI	GCNGC	2 cut(s)	287, 888
FspBI	CTAG	2 cut(s)	227, 680
GluI	GCNGC	2 cut(s)	287, 888
GsaI	CCCAGC	1 cut(s)	620
GsuI	CTGGAG	1 cut(s)	928
Hin1II	CATG	6 cut(s)	506, 595, 608, 665, 733, 857
HinfI	GANTC	9 cut(s)	4, 158, 230, 301, 315, 398, 632, 803, 962
HphI	GGTGA	1 cut(s)	413
Hpy166II	GTNNAC	4 cut(s)	511, 589, 636, 716
Hpy188I	TCNGA	7 cut(s)	33, 118, 300, 339, 624, 802, 937
Hpy188III	TCNNGA	4 cut(s)	605, 680, 826, 907
Hpy8I	GTNNAC	4 cut(s)	511, 589, 636, 716
Hpy99I	CGWCG	1 cut(s)	373
HpyAV	CCTTC	5 cut(s)	426, 506, 564, 841, 846
HpyCH4III	ACNGT	1 cut(s)	428
HpyCH4IV	ACGT	2 cut(s)	368, 952
HpyCH4V	TGCA	5 cut(s)	110, 196, 328, 665, 738
HpyF3I	CTNAG	3 cut(s)	30, 299, 966
HpySE526I	ACGT	2 cut(s)	368, 952
Hsp92II	CATG	6 cut(s)	506, 595, 608, 665, 733, 857
Kzo9I	GATC	3 cut(s)	136, 472, 607
LmnI	GCTCC	1 cut(s)	182
LpnPI	CCDG	8 cut(s)	78, 444, 602, 732, 798, 811, 825, 958
Lsp1109I	GCAGC	2 cut(s)	273, 874
LweI	GCATC	1 cut(s)	337
MaeI	CTAG	2 cut(s)	227, 680
MaeII	ACGT	2 cut(s)	368, 952
MaeIII	GTNAC	3 cut(s)	155, 753, 916
MalI	GATC	3 cut(s)	138, 474, 609
MboI	GATC	3 cut(s)	136, 472, 607
MboII	GAAGA	5 cut(s)	79, 96, 230, 718, 865
MfeI	CAATTG	1 cut(s)	819
MluCI	AATT	8 cut(s)	235, 541, 548, 643, 707, 819, 861, 894
MlyI	GAGTC	4 cut(s)	152, 309, 310, 641
MnlI	CCTC	7 cut(s)	27, 115, 274, 424, 577, 687, 739
MroXI	GAANNNNTTC	1 cut(s)	865
MseI	TTAA	3 cut(s)	311, 384, 893
MslI	CAYNNNNRTG	3 cut(s)	147, 426, 594
MspCI	CTTAAG	1 cut(s)	383
MunI	CAATTG	1 cut(s)	819
NdeII	GATC	3 cut(s)	136, 472, 607
NlaIII	CATG	6 cut(s)	506, 595, 608, 665, 733, 857
NlaIV	GGNNCC	2 cut(s)	11, 621
NmuCI	GTSAC	2 cut(s)	155, 753
NspI	RCATGY	2 cut(s)	665, 857
OliI	CACNNNNGTG	1 cut(s)	426
PagI	TCATGA	1 cut(s)	604
PdmI	GAANNNNTTC	1 cut(s)	865
PfeI	GAWTC	5 cut(s)	4, 230, 398, 803, 962
PkrI	GCNGC	2 cut(s)	288, 889
PleI	GAGTC	4 cut(s)	152, 309, 309, 640
PpsI	GAGTC	4 cut(s)	152, 309, 309, 640
Psp1406I	AACGTT	1 cut(s)	952
PspFI	CCCAGC	1 cut(s)	616
PspN4I	GGNNCC	2 cut(s)	11, 621
PspPI	GGNCC	1 cut(s)	620
PstI	CTGCAG	1 cut(s)	112
RsaI	GTAC	3 cut(s)	512, 715, 817
RsaNI	GTAC	3 cut(s)	511, 714, 816
RseI	CAYNNNNRTG	3 cut(s)	147, 426, 594
SaqAI	TTAA	3 cut(s)	311, 384, 893
SatI	GCNGC	2 cut(s)	287, 888
Sau3AI	GATC	3 cut(s)	136, 472, 607
Sau96I	GGNCC	1 cut(s)	620
SchI	GAGTC	4 cut(s)	152, 309, 310, 641
SfaNI	GCATC	1 cut(s)	337
SfcI	CTRYAG	2 cut(s)	108, 579
SinI	GGWCC	1 cut(s)	620
SmiMI	CAYNNNNRTG	3 cut(s)	147, 426, 594
SmlI	CTYRAG	3 cut(s)	160, 383, 407
SmoI	CTYRAG	3 cut(s)	160, 383, 407
Sse9I	AATT	8 cut(s)	235, 541, 548, 643, 707, 819, 861, 894
SspMI	CTAG	2 cut(s)	227, 680
StyI	CCWWGG	1 cut(s)	13
TaaI	ACNGT	1 cut(s)	428
TaiI	ACGT	2 cut(s)	371, 955
TaqI	TCGA	1 cut(s)	859
TasI	AATT	8 cut(s)	235, 541, 548, 643, 707, 819, 861, 894
TfiI	GAWTC	5 cut(s)	4, 230, 398, 803, 962
Tru1I	TTAA	3 cut(s)	311, 384, 893
Tru9I	TTAA	3 cut(s)	311, 384, 893
TscAI	CASTG	3 cut(s)	72, 431, 745
TseFI	GTSAC	2 cut(s)	155, 753
TseI	GCWGC	2 cut(s)	286, 887
Tsp45I	GTSAC	2 cut(s)	155, 753
TspDTI	ATGAA	5 cut(s)	222, 231, 699, 718, 860
TspRI	CASTG	3 cut(s)	72, 431, 745
Vha464I	CTTAAG	1 cut(s)	383
VpaK11BI	GGWCC	1 cut(s)	620
XapI	RAATTY	3 cut(s)	235, 541, 707
XbaI	TCTAGA	1 cut(s)	679
XceI	RCATGY	2 cut(s)	665, 857
XmiI	GTMKAC	1 cut(s)	635
XmnI	GAANNNNTTC	1 cut(s)	865
XspI	CTAG	2 cut(s)	227, 680

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.