Rh7AG257800

Phosphatidylinositol-glycan biosynthesis class X

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0007198
Physical Location & Seq
Forward (+)
26210678 .. 26214073
3396 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG257800.1

Sequence Viewer

Length: 504 bp
ATGGCTTTTCTCTCAGAACAGAGGAATGGTTCTCATCGTCATCTTACGTCGTCCTTTAGACTTAAGATTGAACAAGAATCCATACTTGAGCTTCCTTCTCACCACTGTGAGGTCATAGTCATTGAGAGACTGCCATCAGGGGTATTTGCCGATCCATTTGAGCTTCAACATCTCCTTCAGCGTGGTGTGTACGGCAATATAGCTGTCTTTGGAGATACAAATTTGGAATTGCCTTCTTTTCTTTCCAATTGTTCTGCTGTAGAGGTTCACATGGATGTTGGTCATGATCTCTTGCTGGGTCCGAGTAAAGAGTCTACCATCAATTTAGAGCTTCCCCTACATGCACGATATCCACCCCTAGATGAAAGTGGCTATTGGGAAGTCAAATTTGGTACACCTGATTTCTTCATGCGTTGCAGTGTTGAGGGAAAACAACTCCAGCAAACGTTCAAAGGAATCTTAGTTGTTGCTATACTATTAGTCAATTCAAATACAATATTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00563 ko01100 map00563 map01100
Pfam Domains
Protein Families
PIG-X

Protein Analysis

167

Amino Acids

18.79

Weight (kDa)

5.4

Isoelectric Point (pI)

40.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PIG-X PF08320 9 - 145 7e-21 PIG-X / PBN1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 314
AclI AACGTT 1 cut(s) 446
AclWI GGATC 1 cut(s) 146
AcsI RAATTY 2 cut(s) 220, 386
AcuI CTGAAG 1 cut(s) 161
AfaI GTAC 2 cut(s) 191, 394
AfiI CCNNNNNNNGG 1 cut(s) 109
AflII CTTAAG 1 cut(s) 62
AgsI TTSAA 4 cut(s) 71, 167, 451, 489
AjuI GAANNNNNNNTTGG 2 cut(s) 372, 404
AleI CACNNNNGTG 1 cut(s) 105
AluBI AGCT 4 cut(s) 91, 163, 203, 331
AluI AGCT 4 cut(s) 91, 163, 203, 331
Alw26I GTCTC 1 cut(s) 121
AlwI GGATC 1 cut(s) 146
ApoI RAATTY 2 cut(s) 220, 386
AspS9I GGNCC 1 cut(s) 299
AsuHPI GGTGA 1 cut(s) 92
AvaII GGWCC 1 cut(s) 299
BccI CCATC 2 cut(s) 142, 326
BceAI ACGGC 1 cut(s) 208
BcoDI GTCTC 1 cut(s) 121
BfaI CTAG 1 cut(s) 359
BfmI CTRYAG 1 cut(s) 258
BfrI CTTAAG 1 cut(s) 62
Bme18I GGWCC 1 cut(s) 299
BmgT120I GGNCC 1 cut(s) 299
BmiI GGNNCC 1 cut(s) 300
BpmI CTGGAG 1 cut(s) 422
BpuEI CTTGAG 1 cut(s) 107
Bsc4I CCNNNNNNNGG 1 cut(s) 109
BseGI GGATG 1 cut(s) 280
BseLI CCNNNNNNNGG 1 cut(s) 109
BseMII CTCAG 1 cut(s) 27
BseYI CCCAGC 1 cut(s) 295
BslI CCNNNNNNNGG 1 cut(s) 109
BsmAI GTCTC 1 cut(s) 121
Bsp143I GATC 2 cut(s) 151, 286
BspCNI CTCAG 1 cut(s) 26
BspHI TCATGA 1 cut(s) 283
BspLI GGNNCC 1 cut(s) 300
BspPI GGATC 1 cut(s) 146
BspTI CTTAAG 1 cut(s) 62
BssMI GATC 2 cut(s) 151, 286
Bst4CI ACNGT 1 cut(s) 107
BstAFI CTTAAG 1 cut(s) 62
BstDEI CTNAG 2 cut(s) 13, 460
BstF5I GGATG 1 cut(s) 280
BstKTI GATC 2 cut(s) 154, 289
BstMAI GTCTC 1 cut(s) 121
BstMBI GATC 2 cut(s) 151, 286
BstNSI RCATGY 1 cut(s) 344
BstSFI CTRYAG 1 cut(s) 258
BtsCI GGATG 1 cut(s) 280
BtsI GCAGTG 1 cut(s) 424
BtsIMutI CAGTG 2 cut(s) 103, 424
CciI TCATGA 1 cut(s) 283
Cfr13I GGNCC 1 cut(s) 299
Csp6I GTAC 2 cut(s) 190, 393
CviAII CATG 4 cut(s) 271, 284, 341, 409
CviJI RGCY 6 cut(s) 5, 91, 163, 203, 331, 372
CviKI_1 RGCY 6 cut(s) 5, 91, 163, 203, 331, 372
CviQI GTAC 2 cut(s) 190, 393
DdeI CTNAG 2 cut(s) 13, 460
DpnI GATC 2 cut(s) 153, 288
DpnII GATC 2 cut(s) 151, 286
Eco32I GATATC 1 cut(s) 350
Eco47I GGWCC 1 cut(s) 299
Eco57I CTGAAG 1 cut(s) 161
EcoRV GATATC 1 cut(s) 350
FaeI CATG 4 cut(s) 274, 287, 344, 412
FaiI YATR 8 cut(s) 83, 116, 200, 272, 285, 342, 410, 473
FatI CATG 4 cut(s) 270, 283, 340, 408
FblI GTMKAC 1 cut(s) 314
FokI GGATG 1 cut(s) 287
FspBI CTAG 1 cut(s) 359
GsaI CCCAGC 1 cut(s) 299
GsuI CTGGAG 1 cut(s) 422
Hin1II CATG 4 cut(s) 274, 287, 344, 412
HinfI GANTC 3 cut(s) 77, 311, 456
HphI GGTGA 1 cut(s) 92
Hpy166II GTNNAC 4 cut(s) 190, 268, 315, 395
Hpy188I TCNGA 2 cut(s) 16, 303
Hpy188III TCNNGA 1 cut(s) 284
Hpy8I GTNNAC 4 cut(s) 190, 268, 315, 395
Hpy99I CGWCG 1 cut(s) 52
HpyAV CCTTC 3 cut(s) 105, 185, 243
HpyCH4III ACNGT 1 cut(s) 107
HpyCH4IV ACGT 2 cut(s) 47, 446
HpyCH4V TGCA 2 cut(s) 344, 417
HpyF3I CTNAG 2 cut(s) 13, 460
HpySE526I ACGT 2 cut(s) 47, 446
Hsp92II CATG 4 cut(s) 274, 287, 344, 412
Kzo9I GATC 2 cut(s) 151, 286
LpnPI CCDG 4 cut(s) 123, 281, 411, 452
MaeI CTAG 1 cut(s) 359
MaeII ACGT 2 cut(s) 47, 446
MalI GATC 2 cut(s) 153, 288
MboI GATC 2 cut(s) 151, 286
MboII GAAGA 1 cut(s) 397
MfeI CAATTG 1 cut(s) 247
MluCI AATT 6 cut(s) 220, 227, 247, 322, 386, 484
MlyI GAGTC 1 cut(s) 320
MnlI CCTC 4 cut(s) 15, 103, 256, 418
MseI TTAA 2 cut(s) 63, 502
MslI CAYNNNNRTG 2 cut(s) 105, 273
MspCI CTTAAG 1 cut(s) 62
MunI CAATTG 1 cut(s) 247
NdeII GATC 2 cut(s) 151, 286
NlaIII CATG 4 cut(s) 274, 287, 344, 412
NlaIV GGNNCC 1 cut(s) 300
NspI RCATGY 1 cut(s) 344
OliI CACNNNNGTG 1 cut(s) 105
PagI TCATGA 1 cut(s) 283
PfeI GAWTC 2 cut(s) 77, 456
PleI GAGTC 1 cut(s) 319
PpsI GAGTC 1 cut(s) 319
Psp1406I AACGTT 1 cut(s) 446
PspFI CCCAGC 1 cut(s) 295
PspN4I GGNNCC 1 cut(s) 300
PspPI GGNCC 1 cut(s) 299
RsaI GTAC 2 cut(s) 191, 394
RsaNI GTAC 2 cut(s) 190, 393
RseI CAYNNNNRTG 2 cut(s) 105, 273
SaqAI TTAA 2 cut(s) 63, 502
Sau3AI GATC 2 cut(s) 151, 286
Sau96I GGNCC 1 cut(s) 299
SchI GAGTC 1 cut(s) 320
SetI ASST 9 cut(s) 50, 93, 114, 165, 205, 267, 333, 400, 449
SfcI CTRYAG 1 cut(s) 258
SinI GGWCC 1 cut(s) 299
SmiMI CAYNNNNRTG 2 cut(s) 105, 273
SmlI CTYRAG 2 cut(s) 62, 86
SmoI CTYRAG 2 cut(s) 62, 86
Sse9I AATT 6 cut(s) 220, 227, 247, 322, 386, 484
SspI AATATT 1 cut(s) 498
SspMI CTAG 1 cut(s) 359
TaaI ACNGT 1 cut(s) 107
TaiI ACGT 2 cut(s) 50, 449
TasI AATT 6 cut(s) 220, 227, 247, 322, 386, 484
TfiI GAWTC 2 cut(s) 77, 456
Tru1I TTAA 2 cut(s) 63, 502
Tru9I TTAA 2 cut(s) 63, 502
TscAI CASTG 2 cut(s) 110, 424
TspDTI ATGAA 2 cut(s) 378, 397
TspRI CASTG 2 cut(s) 110, 424
Vha464I CTTAAG 1 cut(s) 62
VpaK11BI GGWCC 1 cut(s) 299
XapI RAATTY 2 cut(s) 220, 386
XceI RCATGY 1 cut(s) 344
XmiI GTMKAC 1 cut(s) 314
XspI CTAG 1 cut(s) 359
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.