Rmu_sc0001226.1_g000005

Phosphatidylinositol-glycan biosynthesis class X

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001226.1
OG0007198
Physical Location & Seq
Forward (+)
28266 .. 31413
3148 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 969 bp
ctgattcggttccttggtataatggaaactcagaggagaacttttgggttgtgctattccttgtcagtgggggttttcttggtattcttctctggcattggttcttctgcagtttcagatgaggtaaaaaggtgtgatccacactctaatgatagtgactcaagtattagttgtagctccaagaactatgttttgcagtcttactatgaaaaatatgaagacctactagattcaaatttccaagattttatagcacaagaacttcctattggtttgtgtgaggtgctgccacataatctgagtcttgctttaagactctccattttgcatcgcaatctgatagggaatggttcttatcgtcatcttacgtcgtcctttagacttaagattgaacaagaatccatacttgagcttccttctcaccactgtgaggtcatagtcattgagagactgccatctggggtatttgctgatccatttgagcttcaacatctccttcagcatggtgtgtacggcaatatagctgtctttggagatacaaatttggaattgccttcttttctttccaatcgttctgctgtagaggttcacatggatgttggtcatgatctcttgctgggtccgagtaaagagtctaccatcaatttagagcttcccctacatgcacgatatccacctctagatgaaagtggctattgggaagtcaaatttggtacacctgatttcttcatgcgttgcagtgttgagggaaagtcacataatcaaagctgtgtttataggataccagatattgatggttctgattcaacatttggtacaattgtctggaacataccttctgggatgaaggcacatgctcgaattgtttctgtcttcacttttattgctgccttaatttcagccatcttgattgctgtaacatccatattttattcagacaactccagcaaacgttcaaaggaatcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00563 ko01100 map00563 map01100
Pfam Domains
Protein Families
PIG-X

Protein Analysis

322

Amino Acids

35.95

Weight (kDa)

5.5

Isoelectric Point (pI)

45.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PIG-X PF08320 127 - 307 2.6e-22 PIG-X / PBN1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 635
AclI AACGTT 1 cut(s) 952
AclWI GGATC 2 cut(s) 131, 467
AcsI RAATTY 3 cut(s) 235, 541, 707
AcuI CTGAAG 1 cut(s) 482
AfaI GTAC 3 cut(s) 512, 715, 817
AfiI CCNNNNNNNGG 1 cut(s) 430
AflII CTTAAG 1 cut(s) 383
AgsI TTSAA 5 cut(s) 234, 392, 488, 807, 957
AjuI GAANNNNNNNTTGG 4 cut(s) 252, 284, 693, 725
AleI CACNNNNGTG 1 cut(s) 426
AluBI AGCT 6 cut(s) 177, 412, 484, 524, 652, 768
AluI AGCT 6 cut(s) 177, 412, 484, 524, 652, 768
Alw26I GTCTC 1 cut(s) 442
AlwI GGATC 2 cut(s) 131, 467
ApeKI GCWGC 2 cut(s) 286, 887
ApoI RAATTY 3 cut(s) 235, 541, 707
Asp700I GAANNNNTTC 1 cut(s) 865
AspS9I GGNCC 1 cut(s) 620
AsuHPI GGTGA 1 cut(s) 413
AvaII GGWCC 1 cut(s) 620
BaeI ACNNNNGTAYC 2 cut(s) 807, 840
BbsI GAAGAC 2 cut(s) 225, 865
BbvI GCAGC 2 cut(s) 273, 874
BccI CCATC 4 cut(s) 463, 647, 788, 911
BceAI ACGGC 1 cut(s) 529
BciVI GTATCC 1 cut(s) 774
BcoDI GTCTC 1 cut(s) 442
BfaI CTAG 2 cut(s) 227, 680
BfmI CTRYAG 2 cut(s) 108, 579
BfrI CTTAAG 1 cut(s) 383
BfuI GTATCC 1 cut(s) 774
BisI GCNGC 2 cut(s) 287, 888
BlsI GCNGC 2 cut(s) 288, 889
Bme18I GGWCC 1 cut(s) 620
BmgT120I GGNCC 1 cut(s) 620
BmiI GGNNCC 2 cut(s) 11, 621
BmsI GCATC 1 cut(s) 337
BpiI GAAGAC 2 cut(s) 225, 865
BpmI CTGGAG 1 cut(s) 928
BpuEI CTTGAG 2 cut(s) 145, 428
BsaJI CCNNGG 1 cut(s) 13
Bsc4I CCNNNNNNNGG 1 cut(s) 430
BseDI CCNNGG 1 cut(s) 13
BseGI GGATG 3 cut(s) 601, 849, 920
BseLI CCNNNNNNNGG 1 cut(s) 430
BseMII CTCAG 2 cut(s) 44, 290
BseRI GAGGAG 1 cut(s) 49
BseXI GCAGC 2 cut(s) 273, 874
BseYI CCCAGC 1 cut(s) 616
BslI CCNNNNNNNGG 1 cut(s) 430
BsmAI GTCTC 1 cut(s) 442
Bsp143I GATC 3 cut(s) 136, 472, 607
BspCNI CTCAG 2 cut(s) 43, 291
BspHI TCATGA 1 cut(s) 604
BspLI GGNNCC 2 cut(s) 11, 621
BspMAI CTGCAG 1 cut(s) 112
BspPI GGATC 2 cut(s) 131, 467
BspTI CTTAAG 1 cut(s) 383
BssECI CCNNGG 1 cut(s) 13
BssMI GATC 3 cut(s) 136, 472, 607
BssT1I CCWWGG 1 cut(s) 13
Bst4CI ACNGT 1 cut(s) 428
BstAFI CTTAAG 1 cut(s) 383
BstDEI CTNAG 3 cut(s) 30, 299, 966
BstF5I GGATG 3 cut(s) 601, 849, 920
BstKTI GATC 3 cut(s) 139, 475, 610
BstMAI GTCTC 1 cut(s) 442
BstMBI GATC 3 cut(s) 136, 472, 607
BstNSI RCATGY 2 cut(s) 665, 857
BstSFI CTRYAG 2 cut(s) 108, 579
BstV1I GCAGC 2 cut(s) 273, 874
BstV2I GAAGAC 2 cut(s) 225, 865
BsuI GTATCC 1 cut(s) 774
BtgZI GCGATG 1 cut(s) 314
BtsCI GGATG 3 cut(s) 601, 849, 920
BtsI GCAGTG 1 cut(s) 745
BtsIMutI CAGTG 3 cut(s) 72, 424, 745
CciI TCATGA 1 cut(s) 604
Cfr13I GGNCC 1 cut(s) 620
Csp6I GTAC 3 cut(s) 511, 714, 816
CviAII CATG 6 cut(s) 503, 592, 605, 662, 730, 854
CviJI RGCY 8 cut(s) 177, 412, 484, 524, 652, 693, 768, 902
CviKI_1 RGCY 8 cut(s) 177, 412, 484, 524, 652, 693, 768, 902
CviQI GTAC 3 cut(s) 511, 714, 816
DdeI CTNAG 3 cut(s) 30, 299, 966
DpnI GATC 3 cut(s) 138, 474, 609
DpnII GATC 3 cut(s) 136, 472, 607
Eco130I CCWWGG 1 cut(s) 13
Eco32I GATATC 1 cut(s) 671
Eco47I GGWCC 1 cut(s) 620
Eco57I CTGAAG 1 cut(s) 482
EcoRV GATATC 1 cut(s) 671
EcoT14I CCWWGG 1 cut(s) 13
ErhI CCWWGG 1 cut(s) 13
FaeI CATG 6 cut(s) 506, 595, 608, 665, 733, 857
FatI CATG 6 cut(s) 502, 591, 604, 661, 729, 853
FblI GTMKAC 1 cut(s) 635
Fnu4HI GCNGC 2 cut(s) 287, 888
FokI GGATG 3 cut(s) 608, 856, 907
Fsp4HI GCNGC 2 cut(s) 287, 888
FspBI CTAG 2 cut(s) 227, 680
GluI GCNGC 2 cut(s) 287, 888
GsaI CCCAGC 1 cut(s) 620
GsuI CTGGAG 1 cut(s) 928
Hin1II CATG 6 cut(s) 506, 595, 608, 665, 733, 857
HinfI GANTC 9 cut(s) 4, 158, 230, 301, 315, 398, 632, 803, 962
HphI GGTGA 1 cut(s) 413
Hpy166II GTNNAC 4 cut(s) 511, 589, 636, 716
Hpy188I TCNGA 7 cut(s) 33, 118, 300, 339, 624, 802, 937
Hpy188III TCNNGA 4 cut(s) 605, 680, 826, 907
Hpy8I GTNNAC 4 cut(s) 511, 589, 636, 716
Hpy99I CGWCG 1 cut(s) 373
HpyAV CCTTC 5 cut(s) 426, 506, 564, 841, 846
HpyCH4III ACNGT 1 cut(s) 428
HpyCH4IV ACGT 2 cut(s) 368, 952
HpyCH4V TGCA 5 cut(s) 110, 196, 328, 665, 738
HpyF3I CTNAG 3 cut(s) 30, 299, 966
HpySE526I ACGT 2 cut(s) 368, 952
Hsp92II CATG 6 cut(s) 506, 595, 608, 665, 733, 857
Kzo9I GATC 3 cut(s) 136, 472, 607
LmnI GCTCC 1 cut(s) 182
LpnPI CCDG 8 cut(s) 78, 444, 602, 732, 798, 811, 825, 958
Lsp1109I GCAGC 2 cut(s) 273, 874
LweI GCATC 1 cut(s) 337
MaeI CTAG 2 cut(s) 227, 680
MaeII ACGT 2 cut(s) 368, 952
MaeIII GTNAC 3 cut(s) 155, 753, 916
MalI GATC 3 cut(s) 138, 474, 609
MboI GATC 3 cut(s) 136, 472, 607
MboII GAAGA 5 cut(s) 79, 96, 230, 718, 865
MfeI CAATTG 1 cut(s) 819
MluCI AATT 8 cut(s) 235, 541, 548, 643, 707, 819, 861, 894
MlyI GAGTC 4 cut(s) 152, 309, 310, 641
MnlI CCTC 7 cut(s) 27, 115, 274, 424, 577, 687, 739
MroXI GAANNNNTTC 1 cut(s) 865
MseI TTAA 3 cut(s) 311, 384, 893
MslI CAYNNNNRTG 3 cut(s) 147, 426, 594
MspCI CTTAAG 1 cut(s) 383
MunI CAATTG 1 cut(s) 819
NdeII GATC 3 cut(s) 136, 472, 607
NlaIII CATG 6 cut(s) 506, 595, 608, 665, 733, 857
NlaIV GGNNCC 2 cut(s) 11, 621
NmuCI GTSAC 2 cut(s) 155, 753
NspI RCATGY 2 cut(s) 665, 857
OliI CACNNNNGTG 1 cut(s) 426
PagI TCATGA 1 cut(s) 604
PdmI GAANNNNTTC 1 cut(s) 865
PfeI GAWTC 5 cut(s) 4, 230, 398, 803, 962
PkrI GCNGC 2 cut(s) 288, 889
PleI GAGTC 4 cut(s) 152, 309, 309, 640
PpsI GAGTC 4 cut(s) 152, 309, 309, 640
Psp1406I AACGTT 1 cut(s) 952
PspFI CCCAGC 1 cut(s) 616
PspN4I GGNNCC 2 cut(s) 11, 621
PspPI GGNCC 1 cut(s) 620
PstI CTGCAG 1 cut(s) 112
RsaI GTAC 3 cut(s) 512, 715, 817
RsaNI GTAC 3 cut(s) 511, 714, 816
RseI CAYNNNNRTG 3 cut(s) 147, 426, 594
SaqAI TTAA 3 cut(s) 311, 384, 893
SatI GCNGC 2 cut(s) 287, 888
Sau3AI GATC 3 cut(s) 136, 472, 607
Sau96I GGNCC 1 cut(s) 620
SchI GAGTC 4 cut(s) 152, 309, 310, 641
SfaNI GCATC 1 cut(s) 337
SfcI CTRYAG 2 cut(s) 108, 579
SinI GGWCC 1 cut(s) 620
SmiMI CAYNNNNRTG 3 cut(s) 147, 426, 594
SmlI CTYRAG 3 cut(s) 160, 383, 407
SmoI CTYRAG 3 cut(s) 160, 383, 407
Sse9I AATT 8 cut(s) 235, 541, 548, 643, 707, 819, 861, 894
SspMI CTAG 2 cut(s) 227, 680
StyI CCWWGG 1 cut(s) 13
TaaI ACNGT 1 cut(s) 428
TaiI ACGT 2 cut(s) 371, 955
TaqI TCGA 1 cut(s) 859
TasI AATT 8 cut(s) 235, 541, 548, 643, 707, 819, 861, 894
TfiI GAWTC 5 cut(s) 4, 230, 398, 803, 962
Tru1I TTAA 3 cut(s) 311, 384, 893
Tru9I TTAA 3 cut(s) 311, 384, 893
TscAI CASTG 3 cut(s) 72, 431, 745
TseFI GTSAC 2 cut(s) 155, 753
TseI GCWGC 2 cut(s) 286, 887
Tsp45I GTSAC 2 cut(s) 155, 753
TspDTI ATGAA 5 cut(s) 222, 231, 699, 718, 860
TspRI CASTG 3 cut(s) 72, 431, 745
Vha464I CTTAAG 1 cut(s) 383
VpaK11BI GGWCC 1 cut(s) 620
XapI RAATTY 3 cut(s) 235, 541, 707
XbaI TCTAGA 1 cut(s) 679
XceI RCATGY 2 cut(s) 665, 857
XmiI GTMKAC 1 cut(s) 635
XmnI GAANNNNTTC 1 cut(s) 865
XspI CTAG 2 cut(s) 227, 680
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.