Rmu_sc0001246.1_g000012

pentatricopeptide repeat-containing protein At1g31840

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001246.1
Physical Location & Seq
Forward (+)
53758 .. 54310
553 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001246.1_g000012.1.cds

Sequence Viewer

Length: 444 bp
atggtacgccaattcggtactcaatttaacatttctgctgtttttacaaagaattttagtagctacggttcaaatttgagttatgttggtggttttctgattgagaatttttgccgaaatggggagttggattctgctgttgaggcattggtttgtatgtgtgcattgggtgcttcggtgtcgccttttgctgtgtgtagaattttgagtgcttgtgttgatacgaatcgtgtacatgtgattcttgatttatatggaaaattgtgtggacaaggttttggtgtttacgagtttgttatgtcaaggcttttgggcaaaggtgaagttgaaatgggattgaattttcattcagcagtgatggatagaggttttgtgcttgatgagtcgatgggcagccatgggagtggagaagaggaagaagaagaacagaggaggaagaattga

Protein Analysis

147

Amino Acids

16.12

Weight (kDa)

5.01

Isoelectric Point (pI)

36.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 5 cut(s) 52, 73, 106, 201, 340
AfaI GTAC 3 cut(s) 6, 19, 234
AfiI CCNNNNNNNGG 1 cut(s) 121
AflIII ACRYGT 1 cut(s) 235
AgsI TTSAA 3 cut(s) 72, 329, 340
AluBI AGCT 1 cut(s) 63
AluI AGCT 1 cut(s) 63
ApeKI GCWGC 1 cut(s) 393
ApoI RAATTY 5 cut(s) 52, 73, 106, 201, 340
AsuHPI GGTGA 1 cut(s) 332
BbvI GCAGC 1 cut(s) 405
BccI CCATC 2 cut(s) 352, 382
BisI GCNGC 1 cut(s) 394
BlsI GCNGC 1 cut(s) 395
BsaBI GATNNNNATC 1 cut(s) 225
BsaJI CCNNGG 1 cut(s) 397
Bsc4I CCNNNNNNNGG 1 cut(s) 121
Bse8I GATNNNNATC 1 cut(s) 225
BseDI CCNNGG 1 cut(s) 397
BseJI GATNNNNATC 1 cut(s) 225
BseLI CCNNNNNNNGG 1 cut(s) 121
BseXI GCAGC 1 cut(s) 405
BslI CCNNNNNNNGG 1 cut(s) 121
Bsp1407I TGTACA 1 cut(s) 232
Bsp19I CCATGG 1 cut(s) 397
BsrGI TGTACA 1 cut(s) 232
BssECI CCNNGG 1 cut(s) 397
BssT1I CCWWGG 1 cut(s) 397
Bst4CI ACNGT 1 cut(s) 68
Bst6I CTCTTC 1 cut(s) 405
BstAPI GCANNNNNTGC 1 cut(s) 170
BstAUI TGTACA 1 cut(s) 232
BstDSI CCRYGG 1 cut(s) 397
BstMWI GCNNNNNNNGC 2 cut(s) 143, 170
BstNSI RCATGY 1 cut(s) 239
BstV1I GCAGC 1 cut(s) 405
BstXI CCANNNNNNTGG 1 cut(s) 404
BtgI CCRYGG 1 cut(s) 397
BtsI GCAGTG 1 cut(s) 360
BtsIMutI CAGTG 1 cut(s) 360
Csp6I GTAC 3 cut(s) 5, 18, 233
CviAII CATG 2 cut(s) 236, 398
CviJI RGCY 3 cut(s) 63, 307, 396
CviKI_1 RGCY 3 cut(s) 63, 307, 396
CviQI GTAC 3 cut(s) 5, 18, 233
Eam1104I CTCTTC 1 cut(s) 405
EarI CTCTTC 1 cut(s) 405
Eco130I CCWWGG 1 cut(s) 397
EcoT14I CCWWGG 1 cut(s) 397
ErhI CCWWGG 1 cut(s) 397
FaeI CATG 2 cut(s) 239, 401
FaiI YATR 7 cut(s) 84, 158, 237, 253, 255, 299, 399
FatI CATG 2 cut(s) 235, 397
Fnu4HI GCNGC 1 cut(s) 394
Fsp4HI GCNGC 1 cut(s) 394
GluI GCNGC 1 cut(s) 394
Hin1II CATG 2 cut(s) 239, 401
HinfI GANTC 4 cut(s) 131, 226, 241, 383
HphI GGTGA 1 cut(s) 332
Hpy166II GTNNAC 3 cut(s) 233, 269, 286
Hpy188I TCNGA 1 cut(s) 99
Hpy188III TCNNGA 1 cut(s) 245
Hpy8I GTNNAC 3 cut(s) 233, 269, 286
HpyCH4III ACNGT 1 cut(s) 68
HpyCH4V TGCA 1 cut(s) 164
HpyF10VI GCNNNNNNNGC 2 cut(s) 143, 170
Hsp92II CATG 2 cut(s) 239, 401
Lsp1109I GCAGC 1 cut(s) 405
MboII GAAGA 4 cut(s) 422, 428, 431, 434
MluCI AATT 9 cut(s) 11, 23, 52, 73, 106, 201, 260, 340, 439
MlyI GAGTC 1 cut(s) 392
MmeI TCCRAC 1 cut(s) 108
MnlI CCTC 5 cut(s) 136, 359, 406, 423, 426
MseI TTAA 1 cut(s) 27
MslI CAYNNNNRTG 1 cut(s) 402
MwoI GCNNNNNNNGC 2 cut(s) 143, 170
NcoI CCATGG 1 cut(s) 397
NlaIII CATG 2 cut(s) 239, 401
NspI RCATGY 1 cut(s) 239
PciI ACATGT 1 cut(s) 235
PfeI GAWTC 3 cut(s) 131, 226, 241
PkrI GCNGC 1 cut(s) 395
PleI GAGTC 1 cut(s) 391
PpsI GAGTC 1 cut(s) 391
PscI ACATGT 1 cut(s) 235
PsrI GAACNNNNNNTAC 2 cut(s) 52, 84
RsaI GTAC 3 cut(s) 6, 19, 234
RsaNI GTAC 3 cut(s) 5, 18, 233
RseI CAYNNNNRTG 1 cut(s) 402
SaqAI TTAA 1 cut(s) 27
SatI GCNGC 1 cut(s) 394
SchI GAGTC 1 cut(s) 392
SetI ASST 4 cut(s) 65, 277, 322, 370
SgeI CNNG 9 cut(s) 225, 242, 248, 257, 284, 301, 315, 389, 410
SmiMI CAYNNNNRTG 1 cut(s) 402
Sse9I AATT 9 cut(s) 11, 23, 52, 73, 106, 201, 260, 340, 439
StyI CCWWGG 1 cut(s) 397
TaaI ACNGT 1 cut(s) 68
TaqI TCGA 1 cut(s) 386
TasI AATT 9 cut(s) 11, 23, 52, 73, 106, 201, 260, 340, 439
TatI WGTACW 1 cut(s) 232
TfiI GAWTC 3 cut(s) 131, 226, 241
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
TscAI CASTG 1 cut(s) 360
TseI GCWGC 1 cut(s) 393
TspDTI ATGAA 1 cut(s) 335
TspRI CASTG 1 cut(s) 360
XapI RAATTY 5 cut(s) 52, 73, 106, 201, 340
XceI RCATGY 1 cut(s) 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.