Rmu_sc0002525.1_g000013

pentatricopeptide repeat-containing protein At1g31840

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002525.1
Physical Location & Seq
Forward (+)
67606 .. 69049
1444 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002525.1_g000013.1.cds

Sequence Viewer

Length: 846 bp
atggtacgccaattcggtactcaatttaacatttctgctgtttttacagagaattttagtagctacggttcaaatttgagttatgttggtggttttctgattgagaatttttgccgaaatggggagttggattctgctgttgaggcattggtctgtatgtgtgcattgggtgcttcggtgcctcctttgatgtgtgttgcatgtagagaaaatcagagaggagcggaggatttctttgatgtgttactaagggttggtccggagccgaatgtggtgacttttagcaccatgattaacacgtacggtaaagatcggaggttggaagaggcaattaagctttatgaggttatgaaagagaagggtatcagtccggacttggttgtgtatagcattcttattgacagtctctttaaggcagggaagttggaggaggggcatcgacttttttctgttgcattagatagtgggattaagttggatgtagtcatcttcagttctgttatggatgcatatgtaagaactagaaatttggaaaagctagtggagatgtacagaaggatgtataacgaagggatctcacagaacactgttagttacagtccgcacgcctcctctacttcaccctcagcccaccacctcacttgccatgctcctgctgctcaccacaacgcaactagtattgctagccttcggaccgctcgtcccctcgcaccaagctgctgccctcggccttctacctttggcaacaactgcaaactctcctcttccatcgacgccaacttcttcaagctcccaagctttcaaacttcaaggtttcaatctccaattaatcaagatgccgtatga

Protein Analysis

281

Amino Acids

31.01

Weight (kDa)

6.65

Isoelectric Point (pI)

43.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 178
AccBSI CCGCTC 2 cut(s) 224, 698
AccIII TCCGGA 2 cut(s) 259, 370
AciI CCGC 3 cut(s) 224, 602, 696
AclWI GGATC 1 cut(s) 581
AcsI RAATTY 4 cut(s) 52, 73, 106, 526
AcuI CTGAAG 1 cut(s) 475
AcyI GRCGYC 1 cut(s) 774
AfaI GTAC 4 cut(s) 6, 19, 302, 551
AfiI CCNNNNNNNGG 1 cut(s) 121
AflIII ACRYGT 1 cut(s) 297
AgsI TTSAA 5 cut(s) 72, 787, 803, 810, 818
AhdI GACNNNNNGTC 1 cut(s) 699
AhlI ACTAGT 1 cut(s) 674
AluBI AGCT 6 cut(s) 63, 337, 538, 717, 790, 798
AluI AGCT 6 cut(s) 63, 337, 538, 717, 790, 798
Alw26I GTCTC 1 cut(s) 410
AlwI GGATC 1 cut(s) 581
Aor13HI TCCGGA 2 cut(s) 259, 370
AoxI GGCC 1 cut(s) 728
ApeKI GCWGC 3 cut(s) 656, 717, 720
ApoI RAATTY 4 cut(s) 52, 73, 106, 526
AseI ATTAAT 1 cut(s) 828
AspS9I GGNCC 2 cut(s) 257, 693
AsuHPI GGTGA 3 cut(s) 286, 612, 653
AsuNHI GCTAGC 1 cut(s) 683
AvaII GGWCC 2 cut(s) 257, 693
BanI GGYRCC 1 cut(s) 178
BbvCI CCTCAGC 1 cut(s) 625
BbvI GCAGC 3 cut(s) 643, 704, 707
BccI CCATC 1 cut(s) 776
BceAI ACGGC 1 cut(s) 824
BcoDI GTCTC 1 cut(s) 410
BcuI ACTAGT 1 cut(s) 674
BfaI CTAG 4 cut(s) 522, 539, 675, 684
BisI GCNGC 3 cut(s) 657, 718, 721
BlsI GCNGC 3 cut(s) 658, 719, 722
Bme18I GGWCC 2 cut(s) 257, 693
BmeRI GACNNNNNGTC 1 cut(s) 699
BmgT120I GGNCC 2 cut(s) 257, 693
BmiI GGNNCC 2 cut(s) 180, 264
BmsI GCATC 3 cut(s) 445, 496, 826
BmtI GCTAGC 1 cut(s) 687
Bpu10I CCTNAGC 1 cut(s) 625
BsaAI YACGTR 1 cut(s) 300
BsaHI GRCGYC 1 cut(s) 774
BsaJI CCNNGG 1 cut(s) 725
BsaWI WCCGGW 2 cut(s) 259, 370
Bsc4I CCNNNNNNNGG 1 cut(s) 121
BseAI TCCGGA 2 cut(s) 259, 370
BseDI CCNNGG 1 cut(s) 725
BseGI GGATG 3 cut(s) 484, 511, 564
BseLI CCNNNNNNNGG 1 cut(s) 121
BseMII CTCAG 1 cut(s) 639
BseRI GAGGAG 4 cut(s) 234, 443, 601, 751
BseXI GCAGC 3 cut(s) 643, 704, 707
BshFI GGCC 1 cut(s) 730
BshNI GGYRCC 1 cut(s) 178
BsiSI CCGG 2 cut(s) 260, 371
BsiWI CGTACG 1 cut(s) 300
BslFI GGGAC 1 cut(s) 687
BslI CCNNNNNNNGG 1 cut(s) 121
BsmAI GTCTC 1 cut(s) 410
BsmFI GGGAC 1 cut(s) 687
BsmI GAATGC 1 cut(s) 390
BsnI GGCC 1 cut(s) 730
Bsp13I TCCGGA 2 cut(s) 259, 370
Bsp1407I TGTACA 1 cut(s) 549
Bsp143I GATC 2 cut(s) 310, 573
BspACI CCGC 3 cut(s) 224, 602, 696
BspANI GGCC 1 cut(s) 730
BspCNI CTCAG 1 cut(s) 638
BspEI TCCGGA 2 cut(s) 259, 370
BspLI GGNNCC 2 cut(s) 180, 264
BspOI GCTAGC 1 cut(s) 687
BspPI GGATC 1 cut(s) 581
BspT107I GGYRCC 1 cut(s) 178
BsrBI CCGCTC 2 cut(s) 224, 698
BsrGI TGTACA 1 cut(s) 549
BssECI CCNNGG 1 cut(s) 725
BssMI GATC 2 cut(s) 310, 573
BssNI GRCGYC 1 cut(s) 774
Bst4CI ACNGT 5 cut(s) 68, 305, 404, 589, 599
Bst6I CTCTTC 2 cut(s) 318, 769
BstACI GRCGYC 1 cut(s) 774
BstAPI GCANNNNNTGC 2 cut(s) 170, 750
BstAUI TGTACA 1 cut(s) 549
BstBAI YACGTR 1 cut(s) 300
BstC8I GCNNGC 2 cut(s) 606, 685
BstDEI CTNAG 2 cut(s) 248, 625
BstF5I GGATG 3 cut(s) 484, 511, 564
BstKTI GATC 2 cut(s) 313, 576
BstMAI GTCTC 1 cut(s) 410
BstMBI GATC 2 cut(s) 310, 573
BstMWI GCNNNNNNNGC 4 cut(s) 143, 170, 656, 750
BstNSI RCATGY 1 cut(s) 204
BstV1I GCAGC 3 cut(s) 643, 704, 707
BstX2I RGATCY 1 cut(s) 573
BstYI RGATCY 1 cut(s) 573
BsuRI GGCC 1 cut(s) 730
BtsCI GGATG 3 cut(s) 484, 511, 564
BtsIMutI CAGTG 1 cut(s) 585
Cac8I GCNNGC 2 cut(s) 606, 685
Cfr13I GGNCC 2 cut(s) 257, 693
CpoI CGGWCCG 1 cut(s) 693
CseI GACGC 1 cut(s) 782
Csp6I GTAC 4 cut(s) 5, 18, 301, 550
CspCI CAANNNNNGTGG 2 cut(s) 623, 658
CspI CGGWCCG 1 cut(s) 693
CviAII CATG 3 cut(s) 201, 289, 647
CviQI GTAC 4 cut(s) 5, 18, 301, 550
DdeI CTNAG 2 cut(s) 248, 625
DpnI GATC 2 cut(s) 312, 575
DpnII GATC 2 cut(s) 310, 573
DriI GACNNNNNGTC 1 cut(s) 699
Eam1104I CTCTTC 2 cut(s) 318, 769
Eam1105I GACNNNNNGTC 1 cut(s) 699
EarI CTCTTC 2 cut(s) 318, 769
Eco47I GGWCC 2 cut(s) 257, 693
Eco57I CTGAAG 1 cut(s) 475
EcoT22I ATGCAT 1 cut(s) 511
FaeI CATG 3 cut(s) 204, 292, 650
FaqI GGGAC 1 cut(s) 687
FatI CATG 3 cut(s) 200, 288, 646
FauNDI CATATG 1 cut(s) 511
Fnu4HI GCNGC 3 cut(s) 657, 718, 721
FokI GGATG 3 cut(s) 491, 518, 571
Fsp4HI GCNGC 3 cut(s) 657, 718, 721
FspBI CTAG 4 cut(s) 522, 539, 675, 684
GluI GCNGC 3 cut(s) 657, 718, 721
HaeIII GGCC 1 cut(s) 730
HapII CCGG 2 cut(s) 260, 371
HgaI GACGC 1 cut(s) 782
Hin1I GRCGYC 1 cut(s) 774
Hin1II CATG 3 cut(s) 204, 292, 650
HindIII AAGCTT 2 cut(s) 335, 796
HinfI GANTC 1 cut(s) 131
HpaII CCGG 2 cut(s) 260, 371
HphI GGTGA 3 cut(s) 286, 612, 653
Hpy188I TCNGA 4 cut(s) 99, 216, 315, 693
Hpy188III TCNNGA 3 cut(s) 260, 371, 833
Hpy99I CGWCG 1 cut(s) 776
HpyAV CCTTC 5 cut(s) 352, 549, 563, 698, 741
HpyCH4III ACNGT 5 cut(s) 68, 305, 404, 589, 599
HpyCH4IV ACGT 1 cut(s) 299
HpyCH4V TGCA 5 cut(s) 164, 200, 455, 509, 753
HpyF10VI GCNNNNNNNGC 4 cut(s) 143, 170, 656, 750
HpyF3I CTNAG 2 cut(s) 248, 625
HpySE526I ACGT 1 cut(s) 299
Hsp92I GRCGYC 1 cut(s) 774
Hsp92II CATG 3 cut(s) 204, 292, 650
Kpn2I TCCGGA 2 cut(s) 259, 370
Kzo9I GATC 2 cut(s) 310, 573
LmnI GCTCC 4 cut(s) 221, 262, 655, 795
LpnPI CCDG 4 cut(s) 273, 384, 402, 666
Lsp1109I GCAGC 3 cut(s) 643, 704, 707
LweI GCATC 3 cut(s) 445, 496, 826
MaeI CTAG 4 cut(s) 522, 539, 675, 684
MaeII ACGT 1 cut(s) 299
MaeIII GTNAC 3 cut(s) 243, 274, 593
MalI GATC 2 cut(s) 312, 575
MbiI CCGCTC 2 cut(s) 224, 698
MboI GATC 2 cut(s) 310, 573
MboII GAAGA 4 cut(s) 335, 481, 756, 775
MflI RGATCY 1 cut(s) 573
MluCI AATT 8 cut(s) 11, 23, 52, 73, 106, 330, 526, 825
MmeI TCCRAC 4 cut(s) 108, 300, 405, 456
Mph1103I ATGCAT 1 cut(s) 511
MroI TCCGGA 2 cut(s) 259, 370
MseI TTAA 6 cut(s) 27, 294, 333, 411, 471, 828
MspI CCGG 2 cut(s) 260, 371
Mva1269I GAATGC 1 cut(s) 390
MwoI GCNNNNNNNGC 4 cut(s) 143, 170, 656, 750
NdeI CATATG 1 cut(s) 511
NdeII GATC 2 cut(s) 310, 573
NheI GCTAGC 1 cut(s) 683
NlaIII CATG 3 cut(s) 204, 292, 650
NlaIV GGNNCC 2 cut(s) 180, 264
NmeAIII GCCGAG 1 cut(s) 706
NmuCI GTSAC 1 cut(s) 274
NsiI ATGCAT 1 cut(s) 511
NspI RCATGY 1 cut(s) 204
PcsI WCGNNNNNNNCGW 1 cut(s) 697
PctI GAATGC 1 cut(s) 390
PfeI GAWTC 1 cut(s) 131
Pfl23II CGTACG 1 cut(s) 300
PkrI GCNGC 3 cut(s) 658, 719, 722
Ppu21I YACGTR 1 cut(s) 300
PshBI ATTAAT 1 cut(s) 828
PspLI CGTACG 1 cut(s) 300
PspN4I GGNNCC 2 cut(s) 180, 264
PspPI GGNCC 2 cut(s) 257, 693
PsrI GAACNNNNNNTAC 2 cut(s) 52, 84
PsuI RGATCY 1 cut(s) 573
RsaI GTAC 4 cut(s) 6, 19, 302, 551
RsaNI GTAC 4 cut(s) 5, 18, 301, 550
Rsr2I CGGWCCG 1 cut(s) 693
RsrII CGGWCCG 1 cut(s) 693
SaqAI TTAA 6 cut(s) 27, 294, 333, 411, 471, 828
SatI GCNGC 3 cut(s) 657, 718, 721
Sau3AI GATC 2 cut(s) 310, 573
Sau96I GGNCC 2 cut(s) 257, 693
SfaNI GCATC 3 cut(s) 445, 496, 826
SinI GGWCC 2 cut(s) 257, 693
SpeI ACTAGT 1 cut(s) 674
Sse9I AATT 8 cut(s) 11, 23, 52, 73, 106, 330, 526, 825
SsiI CCGC 3 cut(s) 224, 602, 696
SspMI CTAG 4 cut(s) 522, 539, 675, 684
TaaI ACNGT 5 cut(s) 68, 305, 404, 589, 599
TaiI ACGT 1 cut(s) 302
TaqI TCGA 2 cut(s) 439, 771
TasI AATT 8 cut(s) 11, 23, 52, 73, 106, 330, 526, 825
TatI WGTACW 1 cut(s) 549
TfiI GAWTC 1 cut(s) 131
Tru1I TTAA 6 cut(s) 27, 294, 333, 411, 471, 828
Tru9I TTAA 6 cut(s) 27, 294, 333, 411, 471, 828
TscAI CASTG 1 cut(s) 592
TseFI GTSAC 1 cut(s) 274
TseI GCWGC 3 cut(s) 656, 717, 720
Tsp45I GTSAC 1 cut(s) 274
TspDTI ATGAA 1 cut(s) 365
TspRI CASTG 1 cut(s) 592
VpaK11BI GGWCC 2 cut(s) 257, 693
VspI ATTAAT 1 cut(s) 828
XapI RAATTY 4 cut(s) 52, 73, 106, 526
XceI RCATGY 1 cut(s) 204
XspI CTAG 4 cut(s) 522, 539, 675, 684
Zsp2I ATGCAT 1 cut(s) 511
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.