Rmu_sc0011922.1_g000005

pentatricopeptide repeat-containing protein At1g31840

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011922.1
Physical Location & Seq
Reverse (-)
21447 .. 21839
393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011922.1_g000005.1.cds

Sequence Viewer

Length: 393 bp
atggtacgccaattcggtactcaatttaacatttctgctgtttttacagagaattttagtagctacggttcaaatttgagttatgttggtggttttctgattgagaatttttgccgaaatggggagttggattctgctgttaaggcattggtttgtatgtgtgcattgggtgcttcggtgccgccttttgctgtgtgtagaattttgagtgattgtgttgatacgaatcgtgtacatgtgattcttgatatatatggaaaattgtgtggacaaggttttggtgtttacgagtttgttatgtcaaggcttttgggcaaaggtgaagttgaaatgggattgaattttcattcagcagtgatggatagaggttttgtgcttgatgtagttgcttga

Protein Analysis

130

Amino Acids

14.15

Weight (kDa)

5.21

Isoelectric Point (pI)

19.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 178
AciI CCGC 1 cut(s) 182
AcsI RAATTY 5 cut(s) 52, 73, 106, 201, 340
AfaI GTAC 3 cut(s) 6, 19, 234
AfiI CCNNNNNNNGG 1 cut(s) 121
AflIII ACRYGT 1 cut(s) 235
AgsI TTSAA 3 cut(s) 72, 329, 340
AluBI AGCT 1 cut(s) 63
AluI AGCT 1 cut(s) 63
ApoI RAATTY 5 cut(s) 52, 73, 106, 201, 340
AsuHPI GGTGA 1 cut(s) 332
BanI GGYRCC 1 cut(s) 178
BccI CCATC 1 cut(s) 352
BisI GCNGC 1 cut(s) 182
BlsI GCNGC 1 cut(s) 183
BmiI GGNNCC 1 cut(s) 180
BsaBI GATNNNNATC 1 cut(s) 225
Bsc4I CCNNNNNNNGG 1 cut(s) 121
Bse8I GATNNNNATC 1 cut(s) 225
BseJI GATNNNNATC 1 cut(s) 225
BseLI CCNNNNNNNGG 1 cut(s) 121
BshNI GGYRCC 1 cut(s) 178
BslI CCNNNNNNNGG 1 cut(s) 121
Bsp1407I TGTACA 1 cut(s) 232
BspACI CCGC 1 cut(s) 182
BspLI GGNNCC 1 cut(s) 180
BspT107I GGYRCC 1 cut(s) 178
BsrGI TGTACA 1 cut(s) 232
Bst4CI ACNGT 1 cut(s) 68
BstAPI GCANNNNNTGC 1 cut(s) 170
BstAUI TGTACA 1 cut(s) 232
BstMWI GCNNNNNNNGC 2 cut(s) 143, 170
BstNSI RCATGY 1 cut(s) 239
BtsI GCAGTG 1 cut(s) 360
BtsIMutI CAGTG 1 cut(s) 360
Csp6I GTAC 3 cut(s) 5, 18, 233
CviAII CATG 1 cut(s) 236
CviJI RGCY 2 cut(s) 63, 307
CviKI_1 RGCY 2 cut(s) 63, 307
CviQI GTAC 3 cut(s) 5, 18, 233
FaeI CATG 1 cut(s) 239
FaiI YATR 7 cut(s) 84, 158, 237, 251, 253, 255, 299
FatI CATG 1 cut(s) 235
Fnu4HI GCNGC 1 cut(s) 182
Fsp4HI GCNGC 1 cut(s) 182
GluI GCNGC 1 cut(s) 182
Hin1II CATG 1 cut(s) 239
HinfI GANTC 3 cut(s) 131, 226, 241
HphI GGTGA 1 cut(s) 332
Hpy166II GTNNAC 3 cut(s) 233, 269, 286
Hpy188I TCNGA 1 cut(s) 99
Hpy188III TCNNGA 1 cut(s) 245
Hpy8I GTNNAC 3 cut(s) 233, 269, 286
HpyCH4III ACNGT 1 cut(s) 68
HpyCH4V TGCA 1 cut(s) 164
HpyF10VI GCNNNNNNNGC 2 cut(s) 143, 170
Hsp92II CATG 1 cut(s) 239
MluCI AATT 8 cut(s) 11, 23, 52, 73, 106, 201, 260, 340
MmeI TCCRAC 1 cut(s) 108
MnlI CCTC 1 cut(s) 359
MseI TTAA 2 cut(s) 27, 141
MwoI GCNNNNNNNGC 2 cut(s) 143, 170
NlaIII CATG 1 cut(s) 239
NlaIV GGNNCC 1 cut(s) 180
NspI RCATGY 1 cut(s) 239
PciI ACATGT 1 cut(s) 235
PfeI GAWTC 3 cut(s) 131, 226, 241
PkrI GCNGC 1 cut(s) 183
PscI ACATGT 1 cut(s) 235
PspN4I GGNNCC 1 cut(s) 180
PsrI GAACNNNNNNTAC 2 cut(s) 52, 84
RsaI GTAC 3 cut(s) 6, 19, 234
RsaNI GTAC 3 cut(s) 5, 18, 233
SaqAI TTAA 2 cut(s) 27, 141
SatI GCNGC 1 cut(s) 182
SetI ASST 4 cut(s) 65, 277, 322, 370
SgeI CNNG 7 cut(s) 242, 248, 257, 284, 301, 315, 389
Sse9I AATT 8 cut(s) 11, 23, 52, 73, 106, 201, 260, 340
SsiI CCGC 1 cut(s) 182
TaaI ACNGT 1 cut(s) 68
TasI AATT 8 cut(s) 11, 23, 52, 73, 106, 201, 260, 340
TatI WGTACW 1 cut(s) 232
TauI GCSGC 1 cut(s) 184
TfiI GAWTC 3 cut(s) 131, 226, 241
Tru1I TTAA 2 cut(s) 27, 141
Tru9I TTAA 2 cut(s) 27, 141
TscAI CASTG 1 cut(s) 360
TspDTI ATGAA 1 cut(s) 335
TspRI CASTG 1 cut(s) 360
XapI RAATTY 5 cut(s) 52, 73, 106, 201, 340
XceI RCATGY 1 cut(s) 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.