Rmu_sc0001262.1_g000010

Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001262.1
Physical Location & Seq
Forward (+)
39285 .. 40825
1541 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001262.1_g000010.1.cds

Sequence Viewer

Length: 321 bp
atgttcctctctctctctctctcatttccctatttcttccctatttctgagaccaacaaccaaactgggtttggcaacaaggtgcttgaaatggctacagacacctacccacctccaccaccgtattataagctatacaaagattacttgcaagatcccaaatccgctcctgagccgctgccaccaattgaagggacatacgtttgctatggtgcttattacactacggatgacgtgcttccaaggttggaagaactgggggtgcgtcaactgtacccaaaaggcccaaatattggtacgtctacctccgggctagtttaa

Protein Analysis

106

Amino Acids

11.9

Weight (kDa)

4.54

Isoelectric Point (pI)

47.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 129
AccB7I CCANNNNNTGG 1 cut(s) 293
AccBSI CCGCTC 1 cut(s) 167
AccI GTMKAC 1 cut(s) 302
AciI CCGC 2 cut(s) 165, 176
AclWI GGATC 1 cut(s) 149
AfaI GTAC 2 cut(s) 275, 298
AfiI CCNNNNNNNGG 2 cut(s) 191, 293
AgsI TTSAA 2 cut(s) 89, 191
AjiI CACGTC 1 cut(s) 235
AluBI AGCT 1 cut(s) 133
AluI AGCT 1 cut(s) 133
Alw26I GTCTC 1 cut(s) 44
AlwI GGATC 1 cut(s) 149
AoxI GGCC 1 cut(s) 283
ApeKI GCWGC 1 cut(s) 178
AspS9I GGNCC 1 cut(s) 284
AsuC2I CCSGG 1 cut(s) 310
BbvI GCAGC 1 cut(s) 165
BcnI CCSGG 1 cut(s) 310
BcoDI GTCTC 1 cut(s) 44
BfaI CTAG 1 cut(s) 314
BfmI CTRYAG 1 cut(s) 96
BisI GCNGC 2 cut(s) 176, 179
BlsI GCNGC 2 cut(s) 177, 180
Bme1390I CCNGG 1 cut(s) 310
BmgBI CACGTC 1 cut(s) 235
BmgT120I GGNCC 1 cut(s) 284
BmrFI CCNGG 1 cut(s) 310
BmrI ACTGGG 2 cut(s) 75, 266
BmuI ACTGGG 2 cut(s) 75, 266
Bpu10I CCTNAGC 1 cut(s) 171
BpuMI CCSGG 1 cut(s) 310
BsaI GGTCTC 1 cut(s) 44
BsaJI CCNNGG 1 cut(s) 242
Bsc4I CCNNNNNNNGG 2 cut(s) 191, 293
Bse1I ACTGG 2 cut(s) 70, 261
BseDI CCNNGG 1 cut(s) 242
BseGI GGATG 1 cut(s) 235
BseLI CCNNNNNNNGG 2 cut(s) 191, 293
BseMII CTCAG 2 cut(s) 39, 162
BseNI ACTGG 2 cut(s) 70, 261
BseXI GCAGC 1 cut(s) 165
BshFI GGCC 1 cut(s) 285
BsiSI CCGG 1 cut(s) 309
BslFI GGGAC 1 cut(s) 208
BslI CCNNNNNNNGG 2 cut(s) 191, 293
BsmAI GTCTC 1 cut(s) 44
BsmFI GGGAC 1 cut(s) 208
BsnI GGCC 1 cut(s) 285
Bso31I GGTCTC 1 cut(s) 44
Bsp143I GATC 1 cut(s) 154
BspACI CCGC 2 cut(s) 165, 176
BspANI GGCC 1 cut(s) 285
BspCNI CTCAG 2 cut(s) 40, 163
BspPI GGATC 1 cut(s) 149
BspTNI GGTCTC 1 cut(s) 44
BsrBI CCGCTC 1 cut(s) 167
BsrI ACTGG 2 cut(s) 70, 261
BssECI CCNNGG 1 cut(s) 242
BssMI GATC 1 cut(s) 154
BssT1I CCWWGG 1 cut(s) 242
Bst4CI ACNGT 2 cut(s) 123, 273
BstDEI CTNAG 2 cut(s) 48, 171
BstF5I GGATG 1 cut(s) 235
BstKTI GATC 1 cut(s) 157
BstMAI GTCTC 1 cut(s) 44
BstMBI GATC 1 cut(s) 154
BstSCI CCNGG 1 cut(s) 308
BstSFI CTRYAG 1 cut(s) 96
BstV1I GCAGC 1 cut(s) 165
BstX2I RGATCY 1 cut(s) 154
BstYI RGATCY 1 cut(s) 154
BsuRI GGCC 1 cut(s) 285
BtrI CACGTC 1 cut(s) 235
BtsCI GGATG 1 cut(s) 235
Cfr13I GGNCC 1 cut(s) 284
CseI GACGC 1 cut(s) 254
Csp6I GTAC 2 cut(s) 274, 297
CviJI RGCY 5 cut(s) 95, 133, 175, 285, 313
CviKI_1 RGCY 5 cut(s) 95, 133, 175, 285, 313
CviQI GTAC 2 cut(s) 274, 297
DdeI CTNAG 2 cut(s) 48, 171
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
Eco130I CCWWGG 1 cut(s) 242
Eco31I GGTCTC 1 cut(s) 44
EcoT14I CCWWGG 1 cut(s) 242
ErhI CCWWGG 1 cut(s) 242
FaiI YATR 4 cut(s) 129, 136, 199, 210
FaqI GGGAC 1 cut(s) 208
FblI GTMKAC 1 cut(s) 302
Fnu4HI GCNGC 2 cut(s) 176, 179
FokI GGATG 1 cut(s) 242
Fsp4HI GCNGC 2 cut(s) 176, 179
FspBI CTAG 1 cut(s) 314
GluI GCNGC 2 cut(s) 176, 179
HaeIII GGCC 1 cut(s) 285
HapII CCGG 1 cut(s) 309
HgaI GACGC 1 cut(s) 254
HincII GTYRAC 1 cut(s) 269
HindII GTYRAC 1 cut(s) 269
HpaII CCGG 1 cut(s) 309
Hpy166II GTNNAC 2 cut(s) 269, 303
Hpy188I TCNGA 1 cut(s) 49
Hpy188III TCNNGA 1 cut(s) 170
Hpy8I GTNNAC 2 cut(s) 269, 303
HpyAV CCTTC 1 cut(s) 185
HpyCH4III ACNGT 2 cut(s) 123, 273
HpyCH4IV ACGT 3 cut(s) 201, 234, 299
HpyCH4V TGCA 1 cut(s) 151
HpyF3I CTNAG 2 cut(s) 48, 171
HpySE526I ACGT 3 cut(s) 201, 234, 299
Kzo9I GATC 1 cut(s) 154
LmnI GCTCC 1 cut(s) 172
LpnPI CCDG 3 cut(s) 51, 183, 242
Lsp1109I GCAGC 1 cut(s) 165
MaeI CTAG 1 cut(s) 314
MaeII ACGT 3 cut(s) 201, 234, 299
MalI GATC 1 cut(s) 156
MbiI CCGCTC 1 cut(s) 167
MboI GATC 1 cut(s) 154
MboII GAAGA 2 cut(s) 28, 263
MfeI CAATTG 1 cut(s) 186
MflI RGATCY 1 cut(s) 154
MluCI AATT 1 cut(s) 186
MmeI TCCRAC 1 cut(s) 228
MnlI CCTC 3 cut(s) 17, 123, 316
MseI TTAA 1 cut(s) 319
MspA1I CMGCKG 1 cut(s) 178
MspI CCGG 1 cut(s) 309
MspR9I CCNGG 1 cut(s) 310
MunI CAATTG 1 cut(s) 186
NciI CCSGG 1 cut(s) 310
NdeII GATC 1 cut(s) 154
PflMI CCANNNNNTGG 1 cut(s) 293
PkrI GCNGC 2 cut(s) 177, 180
PsiI TTATAA 1 cut(s) 129
PspPI GGNCC 1 cut(s) 284
PsuI RGATCY 1 cut(s) 154
RsaI GTAC 2 cut(s) 275, 298
RsaNI GTAC 2 cut(s) 274, 297
SaqAI TTAA 1 cut(s) 319
SatI GCNGC 2 cut(s) 176, 179
Sau3AI GATC 1 cut(s) 154
Sau96I GGNCC 1 cut(s) 284
ScrFI CCNGG 1 cut(s) 310
SetI ASST 9 cut(s) 84, 107, 115, 135, 204, 237, 248, 302, 308
SfcI CTRYAG 1 cut(s) 96
SgeI CNNG 9 cut(s) 78, 91, 98, 160, 164, 182, 247, 255, 269
Sse9I AATT 1 cut(s) 186
SsiI CCGC 2 cut(s) 165, 176
SspI AATATT 1 cut(s) 292
SspMI CTAG 1 cut(s) 314
StyD4I CCNGG 1 cut(s) 308
StyI CCWWGG 1 cut(s) 242
TaaI ACNGT 2 cut(s) 123, 273
TaiI ACGT 3 cut(s) 204, 237, 302
TasI AATT 1 cut(s) 186
TauI GCSGC 1 cut(s) 178
Tru1I TTAA 1 cut(s) 319
Tru9I TTAA 1 cut(s) 319
TseI GCWGC 1 cut(s) 178
TspGWI ACGGA 1 cut(s) 242
Van91I CCANNNNNTGG 1 cut(s) 293
XcmI CCANNNNNNNNNTGG 1 cut(s) 68
XmiI GTMKAC 1 cut(s) 302
XspI CTAG 1 cut(s) 314
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.