Rh7CG431200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0011614
Physical Location & Seq
Reverse (-)
56428712 .. 56431762
3051 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG431200.1

Sequence Viewer

Length: 165 bp
ATGCACCTATGCGTGATCTACGTGGCAAACAATTACTGGTACGCTTGGATAGTAGGCCCTGCAGGTGCAACTGGTTACCTGAAGATCCGGTCATCTGACCTTTTAGAGCATTTGAAATTCGAAACCAAGGGCAACAAACGTACCCAATCCCCCATTGACATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.2

Weight (kDa)

8.89

Isoelectric Point (pI)

44.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 53
Acc36I ACCTGC 1 cut(s) 53
AclWI GGATC 1 cut(s) 79
AcsI RAATTY 1 cut(s) 116
AcuI CTGAAG 1 cut(s) 101
AfaI GTAC 2 cut(s) 41, 142
AflIII ACRYGT 1 cut(s) 159
AgsI TTSAA 1 cut(s) 115
AlwI GGATC 1 cut(s) 79
AoxI GGCC 1 cut(s) 55
ApoI RAATTY 1 cut(s) 116
AspS9I GGNCC 1 cut(s) 56
AsuII TTCGAA 1 cut(s) 120
BaeI ACNNNNGTAYC 2 cut(s) 124, 157
BfmI CTRYAG 1 cut(s) 60
BfuAI ACCTGC 1 cut(s) 53
BmgT120I GGNCC 1 cut(s) 56
Bpu14I TTCGAA 1 cut(s) 120
BsaAI YACGTR 1 cut(s) 22
BsaJI CCNNGG 1 cut(s) 126
BsaWI WCCGGW 1 cut(s) 87
Bse1I ACTGG 2 cut(s) 41, 76
BseDI CCNNGG 1 cut(s) 126
BseNI ACTGG 2 cut(s) 41, 76
BshFI GGCC 1 cut(s) 57
BsiSI CCGG 1 cut(s) 88
BsnI GGCC 1 cut(s) 57
Bsp119I TTCGAA 1 cut(s) 120
Bsp143I GATC 2 cut(s) 15, 84
BspANI GGCC 1 cut(s) 57
BspMAI CTGCAG 1 cut(s) 64
BspMI ACCTGC 1 cut(s) 53
BspPI GGATC 1 cut(s) 79
BspT104I TTCGAA 1 cut(s) 120
BsrI ACTGG 2 cut(s) 41, 76
BssECI CCNNGG 1 cut(s) 126
BssMI GATC 2 cut(s) 15, 84
BssT1I CCWWGG 1 cut(s) 126
BstBAI YACGTR 1 cut(s) 22
BstBI TTCGAA 1 cut(s) 120
BstEII GGTNACC 1 cut(s) 74
BstKTI GATC 2 cut(s) 18, 87
BstMBI GATC 2 cut(s) 15, 84
BstNSI RCATGY 1 cut(s) 163
BstPI GGTNACC 1 cut(s) 74
BstSFI CTRYAG 1 cut(s) 60
BstX2I RGATCY 1 cut(s) 84
BstYI RGATCY 1 cut(s) 84
BsuRI GGCC 1 cut(s) 57
BveI ACCTGC 1 cut(s) 53
Cfr13I GGNCC 1 cut(s) 56
Csp6I GTAC 2 cut(s) 40, 141
CviAII CATG 1 cut(s) 160
CviJI RGCY 1 cut(s) 57
CviKI_1 RGCY 1 cut(s) 57
CviQI GTAC 2 cut(s) 40, 141
DpnI GATC 2 cut(s) 17, 86
DpnII GATC 2 cut(s) 15, 84
Eco130I CCWWGG 1 cut(s) 126
Eco57I CTGAAG 1 cut(s) 101
Eco91I GGTNACC 1 cut(s) 74
EcoO109I RGGNCCY 1 cut(s) 56
EcoO65I GGTNACC 1 cut(s) 74
EcoT14I CCWWGG 1 cut(s) 126
ErhI CCWWGG 1 cut(s) 126
FaeI CATG 1 cut(s) 163
FaiI YATR 2 cut(s) 10, 161
FatI CATG 1 cut(s) 159
HaeIII GGCC 1 cut(s) 57
HapII CCGG 1 cut(s) 88
Hin1II CATG 1 cut(s) 163
HpaII CCGG 1 cut(s) 88
Hpy188I TCNGA 1 cut(s) 97
HpyCH4IV ACGT 2 cut(s) 21, 139
HpyCH4V TGCA 3 cut(s) 4, 62, 68
HpySE526I ACGT 2 cut(s) 21, 139
Hsp92II CATG 1 cut(s) 163
Kzo9I GATC 2 cut(s) 15, 84
LpnPI CCDG 6 cut(s) 22, 48, 57, 72, 92, 101
MaeII ACGT 2 cut(s) 21, 139
MaeIII GTNAC 1 cut(s) 74
MalI GATC 2 cut(s) 17, 86
MboI GATC 2 cut(s) 15, 84
MboII GAAGA 1 cut(s) 94
MflI RGATCY 1 cut(s) 84
MluCI AATT 2 cut(s) 31, 116
MslI CAYNNNNRTG 1 cut(s) 158
MspI CCGG 1 cut(s) 88
NdeII GATC 2 cut(s) 15, 84
NlaIII CATG 1 cut(s) 163
NspI RCATGY 1 cut(s) 163
NspV TTCGAA 1 cut(s) 120
PaqCI CACCTGC 1 cut(s) 53
PciI ACATGT 1 cut(s) 159
Ppu21I YACGTR 1 cut(s) 22
PscI ACATGT 1 cut(s) 159
PspEI GGTNACC 1 cut(s) 74
PspPI GGNCC 1 cut(s) 56
PstI CTGCAG 1 cut(s) 64
PsuI RGATCY 1 cut(s) 84
RsaI GTAC 2 cut(s) 41, 142
RsaNI GTAC 2 cut(s) 40, 141
RseI CAYNNNNRTG 1 cut(s) 158
Sau3AI GATC 2 cut(s) 15, 84
Sau96I GGNCC 1 cut(s) 56
SbfI CCTGCAGG 1 cut(s) 64
SdaI CCTGCAGG 1 cut(s) 64
SetI ASST 6 cut(s) 9, 24, 67, 81, 102, 142
SfcI CTRYAG 1 cut(s) 60
SfuI TTCGAA 1 cut(s) 120
SmiMI CAYNNNNRTG 1 cut(s) 158
Sse8387I CCTGCAGG 1 cut(s) 64
Sse9I AATT 2 cut(s) 31, 116
StyI CCWWGG 1 cut(s) 126
TaiI ACGT 2 cut(s) 24, 142
TaqI TCGA 1 cut(s) 120
TasI AATT 2 cut(s) 31, 116
XapI RAATTY 1 cut(s) 116
XceI RCATGY 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.