Rmu_sc0008105.1_g000006

Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008105.1
Physical Location & Seq
Forward (+)
31224 .. 35330
4107 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008105.1_g000006.1.cds

Sequence Viewer

Length: 738 bp
atggggacggggacagagaatccccagtttattattacggggattgaggcggataaggggatgtggaatgaagtcgggtatgaggatgatcaagaattgatgagtgatgttggttcttgtccggccagatttagtgccactgttaatgctgctcctagtgcagctgctaataccgagaataagaatagagaagaacaagctccaatgtggcaatttggtggctttcattttttttttggtgtcaaagcggtggttttgcttgtcaagatggatatgctacttgaacaaacagcgtttggcaacaaggtgcttgaaatggctacagacacctacccacctccaccaccgtattataagctatacagagattacttgcaagatcccaaatccgctcctgagccgctgccaccaattgaagggacatacgtttgctatggtgctaattacactacggatgacgtgcttccaaggttggaagaactgggggtgcgtcaactgtacccaaaaggcccaaataatgatcatcctcgtcctccacctccagcagctttcactacctctccaaggtgcctcctccgtggcaccgccattcttcaggtcctaaacggtcacatccgcttccccaactcccacgacattgtttttggcaaggttcacccccttctctctccccgttctccttttagttctgattttagtggaattagaaacagtgatgatccgatatgtgattcttga

Protein Analysis

245

Amino Acids

27.13

Weight (kDa)

4.93

Isoelectric Point (pI)

51.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 354
AccB1I GGYRCC 2 cut(s) 567, 581
AccBSI CCGCTC 1 cut(s) 392
AciI CCGC 6 cut(s) 50, 248, 390, 401, 585, 616
AclWI GGATC 2 cut(s) 374, 713
AcoI YGGCCR 1 cut(s) 123
AcuI CTGAAG 1 cut(s) 578
AfaI GTAC 1 cut(s) 500
AfiI CCNNNNNNNGG 2 cut(s) 416, 564
AgsI TTSAA 3 cut(s) 284, 314, 416
AjiI CACGTC 1 cut(s) 460
AluBI AGCT 4 cut(s) 164, 200, 358, 548
AluI AGCT 4 cut(s) 164, 200, 358, 548
AlwI GGATC 2 cut(s) 374, 713
AoxI GGCC 2 cut(s) 123, 508
ApeKI GCWGC 5 cut(s) 149, 161, 164, 403, 545
ArsI GACNNNNNNTTYG 2 cut(s) 626, 658
AspS9I GGNCC 2 cut(s) 509, 598
AsuHPI GGTGA 1 cut(s) 647
AvaII GGWCC 1 cut(s) 598
BanI GGYRCC 2 cut(s) 567, 581
BbvI GCAGC 5 cut(s) 136, 151, 173, 390, 557
BccI CCATC 1 cut(s) 262
BclI TGATCA 2 cut(s) 88, 520
BfaI CTAG 1 cut(s) 156
BfmI CTRYAG 1 cut(s) 321
BisI GCNGC 6 cut(s) 150, 162, 165, 401, 404, 546
BlsI GCNGC 6 cut(s) 151, 163, 166, 402, 405, 547
Bme18I GGWCC 1 cut(s) 598
BmgBI CACGTC 1 cut(s) 460
BmgT120I GGNCC 2 cut(s) 509, 598
BmiI GGNNCC 2 cut(s) 569, 583
BmrI ACTGGG 2 cut(s) 19, 491
BmuI ACTGGG 2 cut(s) 19, 491
BpmI CTGGAG 1 cut(s) 525
Bpu10I CCTNAGC 1 cut(s) 396
BsaJI CCNNGG 3 cut(s) 467, 563, 577
BsaXI ACNNNNNCTCC 2 cut(s) 544, 574
Bsc4I CCNNNNNNNGG 2 cut(s) 416, 564
Bse1I ACTGG 2 cut(s) 25, 486
BseDI CCNNGG 3 cut(s) 467, 563, 577
BseGI GGATG 5 cut(s) 66, 91, 460, 523, 612
BseLI CCNNNNNNNGG 2 cut(s) 416, 564
BseMII CTCAG 1 cut(s) 387
BseNI ACTGG 2 cut(s) 25, 486
BseRI GAGGAG 1 cut(s) 563
BseXI GCAGC 5 cut(s) 136, 151, 173, 390, 557
BsgI GTGCAG 1 cut(s) 180
BshFI GGCC 2 cut(s) 125, 510
BshNI GGYRCC 2 cut(s) 567, 581
BsiSI CCGG 1 cut(s) 122
BslFI GGGAC 3 cut(s) 19, 25, 433
BslI CCNNNNNNNGG 2 cut(s) 416, 564
BsmFI GGGAC 3 cut(s) 19, 25, 433
BsnI GGCC 2 cut(s) 125, 510
Bsp143I GATC 4 cut(s) 88, 379, 520, 718
BspACI CCGC 6 cut(s) 50, 248, 390, 401, 585, 616
BspANI GGCC 2 cut(s) 125, 510
BspCNI CTCAG 1 cut(s) 388
BspLI GGNNCC 2 cut(s) 569, 583
BspPI GGATC 2 cut(s) 374, 713
BspT107I GGYRCC 2 cut(s) 567, 581
BsrBI CCGCTC 1 cut(s) 392
BsrI ACTGG 2 cut(s) 25, 486
BssECI CCNNGG 3 cut(s) 467, 563, 577
BssMI GATC 4 cut(s) 88, 379, 520, 718
BssT1I CCWWGG 2 cut(s) 467, 563
Bst4CI ACNGT 5 cut(s) 142, 348, 498, 608, 713
BstDEI CTNAG 1 cut(s) 396
BstDSI CCRYGG 1 cut(s) 577
BstENI CCTNNNNNAGG 1 cut(s) 562
BstF5I GGATG 5 cut(s) 66, 91, 460, 523, 612
BstKTI GATC 4 cut(s) 91, 382, 523, 721
BstMBI GATC 4 cut(s) 88, 379, 520, 718
BstMWI GCNNNNNNNGC 1 cut(s) 158
BstSFI CTRYAG 1 cut(s) 321
BstV1I GCAGC 5 cut(s) 136, 151, 173, 390, 557
BstX2I RGATCY 1 cut(s) 379
BstYI RGATCY 1 cut(s) 379
BsuRI GGCC 2 cut(s) 125, 510
BtgI CCRYGG 1 cut(s) 577
BtrI CACGTC 1 cut(s) 460
BtsCI GGATG 5 cut(s) 66, 91, 460, 523, 612
BtsIMutI CAGTG 2 cut(s) 138, 718
Cfr13I GGNCC 2 cut(s) 509, 598
CseI GACGC 1 cut(s) 479
Csp6I GTAC 1 cut(s) 499
CviJI RGCY 9 cut(s) 125, 164, 200, 222, 320, 358, 400, 510, 548
CviKI_1 RGCY 9 cut(s) 125, 164, 200, 222, 320, 358, 400, 510, 548
CviQI GTAC 1 cut(s) 499
DdeI CTNAG 1 cut(s) 396
DpnI GATC 4 cut(s) 90, 381, 522, 720
DpnII GATC 4 cut(s) 88, 379, 520, 718
EaeI YGGCCR 1 cut(s) 123
EciI GGCGGA 1 cut(s) 65
Eco130I CCWWGG 2 cut(s) 467, 563
Eco47I GGWCC 1 cut(s) 598
Eco57I CTGAAG 1 cut(s) 578
EcoNI CCTNNNNNAGG 1 cut(s) 562
EcoO109I RGGNCCY 1 cut(s) 598
EcoT14I CCWWGG 2 cut(s) 467, 563
ErhI CCWWGG 2 cut(s) 467, 563
FaiI YATR 7 cut(s) 81, 275, 354, 361, 424, 435, 727
FaqI GGGAC 3 cut(s) 19, 25, 433
FbaI TGATCA 2 cut(s) 88, 520
Fnu4HI GCNGC 6 cut(s) 150, 162, 165, 401, 404, 546
FokI GGATG 5 cut(s) 73, 98, 467, 510, 599
Fsp4HI GCNGC 6 cut(s) 150, 162, 165, 401, 404, 546
FspBI CTAG 1 cut(s) 156
GluI GCNGC 6 cut(s) 150, 162, 165, 401, 404, 546
GsuI CTGGAG 1 cut(s) 525
HaeIII GGCC 2 cut(s) 125, 510
HapII CCGG 1 cut(s) 122
HgaI GACGC 1 cut(s) 479
HincII GTYRAC 1 cut(s) 494
HindII GTYRAC 1 cut(s) 494
HinfI GANTC 2 cut(s) 19, 731
HpaII CCGG 1 cut(s) 122
HphI GGTGA 1 cut(s) 647
Hpy166II GTNNAC 2 cut(s) 494, 655
Hpy188I TCNGA 2 cut(s) 691, 723
Hpy188III TCNNGA 4 cut(s) 92, 265, 395, 735
Hpy8I GTNNAC 2 cut(s) 494, 655
HpyAV CCTTC 2 cut(s) 410, 671
HpyCH4III ACNGT 5 cut(s) 142, 348, 498, 608, 713
HpyCH4IV ACGT 2 cut(s) 426, 459
HpyCH4V TGCA 2 cut(s) 161, 376
HpyF10VI GCNNNNNNNGC 1 cut(s) 158
HpyF3I CTNAG 1 cut(s) 396
HpySE526I ACGT 2 cut(s) 426, 459
Ksp22I TGATCA 2 cut(s) 88, 520
Kzo9I GATC 4 cut(s) 88, 379, 520, 718
LmnI GCTCC 3 cut(s) 157, 205, 397
LpnPI CCDG 7 cut(s) 38, 135, 139, 408, 467, 555, 581
Lsp1109I GCAGC 5 cut(s) 136, 151, 173, 390, 557
MaeI CTAG 1 cut(s) 156
MaeII ACGT 2 cut(s) 426, 459
MaeIII GTNAC 1 cut(s) 608
MalI GATC 4 cut(s) 90, 381, 522, 720
MbiI CCGCTC 1 cut(s) 392
MboI GATC 4 cut(s) 88, 379, 520, 718
MboII GAAGA 3 cut(s) 203, 488, 584
MfeI CAATTG 1 cut(s) 411
MflI RGATCY 1 cut(s) 379
MluCI AATT 5 cut(s) 95, 212, 411, 442, 702
MmeI TCCRAC 1 cut(s) 453
MnlI CCTC 9 cut(s) 40, 76, 348, 537, 543, 549, 568, 581, 584
MseI TTAA 1 cut(s) 144
MspA1I CMGCKG 2 cut(s) 164, 403
MspI CCGG 1 cut(s) 122
MunI CAATTG 1 cut(s) 411
MwoI GCNNNNNNNGC 1 cut(s) 158
NdeII GATC 4 cut(s) 88, 379, 520, 718
NlaIV GGNNCC 2 cut(s) 569, 583
NmuCI GTSAC 1 cut(s) 608
PfeI GAWTC 2 cut(s) 19, 731
PkrI GCNGC 6 cut(s) 151, 163, 166, 402, 405, 547
PpuMI RGGWCCY 1 cut(s) 598
PsiI TTATAA 1 cut(s) 354
Psp5II RGGWCCY 1 cut(s) 598
PspN4I GGNNCC 2 cut(s) 569, 583
PspPI GGNCC 2 cut(s) 509, 598
PspPPI RGGWCCY 1 cut(s) 598
PsuI RGATCY 1 cut(s) 379
PvuII CAGCTG 1 cut(s) 164
RsaI GTAC 1 cut(s) 500
RsaNI GTAC 1 cut(s) 499
SaqAI TTAA 1 cut(s) 144
SatI GCNGC 6 cut(s) 150, 162, 165, 401, 404, 546
Sau3AI GATC 4 cut(s) 88, 379, 520, 718
Sau96I GGNCC 2 cut(s) 509, 598
SfcI CTRYAG 1 cut(s) 321
SinI GGWCC 1 cut(s) 598
Sse9I AATT 5 cut(s) 95, 212, 411, 442, 702
SsiI CCGC 6 cut(s) 50, 248, 390, 401, 585, 616
SspMI CTAG 1 cut(s) 156
StyI CCWWGG 2 cut(s) 467, 563
TaaI ACNGT 5 cut(s) 142, 348, 498, 608, 713
TaiI ACGT 2 cut(s) 429, 462
TasI AATT 5 cut(s) 95, 212, 411, 442, 702
TauI GCSGC 1 cut(s) 403
TfiI GAWTC 2 cut(s) 19, 731
Tru1I TTAA 1 cut(s) 144
Tru9I TTAA 1 cut(s) 144
TscAI CASTG 2 cut(s) 145, 718
TseFI GTSAC 1 cut(s) 608
TseI GCWGC 5 cut(s) 149, 161, 164, 403, 545
Tsp45I GTSAC 1 cut(s) 608
TspDTI ATGAA 2 cut(s) 84, 215
TspGWI ACGGA 2 cut(s) 467, 566
TspRI CASTG 2 cut(s) 145, 718
VpaK11BI GGWCC 1 cut(s) 598
XagI CCTNNNNNAGG 1 cut(s) 562
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.