Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001501.1

Orthogroup ID

OG0007813

Physical Location & Seq

Genomic Coordinates Forward (+)

166393 .. 167372

Gene Structure 980 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001501.1_g000037.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 336 bp

atgcaggaagagattgaatcggaggctgagagtttaggggacatggggaagctcatatgtttggtgagtggattaggtcctgacgatgttagtgagcattgtgttcttagtaggataaacaaagttgattatgatgaaggcaagaggcatatggaacaggagtatgctaaacgagctggtgaaaattgggctgctatagactgctttagaaatatgattagatcaaaagttgggtatgaaagtgtgacattagttattattattgtaggcacaaataatttggaggtggggaaacagattcatggtgctgctttggaggttaaaggtttcagctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003729 GO:0005488 GO:0097159 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF1771 PAM2 PPR PPR_2 Smr

Protein Analysis

111

Amino Acids

12.27

Weight (kDa)

4.89

Isoelectric Point (pI)

36.47

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007813)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G33170
fragaria_vesca	FvH4_2g30790
malus_domestica	MD08G1046200.v1.1 MD15G1047600.v1.1
prunus_persica	Prupe.1G402000_v2.0.a1
rosa_chinensis	RchiOBHm_Chr6g0312061 RchiOBHm_Chr6g0312101 RchiOBHm_Chr7g0217531
rosa_laevigata	RLG00000010354 RLG00000010356
rosa_multiflora	Rmu_sc0001501.1_g000037
rosa_roxburghii	Rroxscaffold_7G00157070 Rroxscaffold_7G00157080
rosa_rugosa	Rorug06G0392600
rosa_samantha	Rh6AG509100 Rh6AG509400 Rh6BG520400 Rh6BG520500 Rh6CG526300 Rh6CG526400 Rh6DG511800 Rh6DG511900
rosa_wichuraiana	Rw6G044330 Rw6G044340

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	17
AluBI	AGCT	3 cut(s)	52, 176, 333
AluI	AGCT	3 cut(s)	52, 176, 333
ApeKI	GCWGC	2 cut(s)	191, 308
AspS9I	GGNCC	1 cut(s)	77
AsuHPI	GGTGA	2 cut(s)	76, 191
AvaII	GGWCC	1 cut(s)	77
BbvI	GCAGC	2 cut(s)	178, 295
BfmI	CTRYAG	1 cut(s)	195
BisI	GCNGC	2 cut(s)	192, 309
BlsI	GCNGC	2 cut(s)	193, 310
Bme18I	GGWCC	1 cut(s)	77
BmgT120I	GGNCC	1 cut(s)	77
BseMII	CTCAG	1 cut(s)	18
BseXI	GCAGC	2 cut(s)	178, 295
BslFI	GGGAC	1 cut(s)	53
BsmFI	GGGAC	1 cut(s)	53
Bsp143I	GATC	1 cut(s)	221
BspCNI	CTCAG	1 cut(s)	19
BssMI	GATC	1 cut(s)	221
Bst6I	CTCTTC	1 cut(s)	3
BstDEI	CTNAG	2 cut(s)	27, 107
BstKTI	GATC	1 cut(s)	224
BstMBI	GATC	1 cut(s)	221
BstMWI	GCNNNNNNNGC	1 cut(s)	173
BstSFI	CTRYAG	1 cut(s)	195
BstV1I	GCAGC	2 cut(s)	178, 295
Cfr13I	GGNCC	1 cut(s)	77
CviAII	CATG	2 cut(s)	43, 302
CviJI	RGCY	5 cut(s)	26, 52, 176, 191, 333
CviKI_1	RGCY	5 cut(s)	26, 52, 176, 191, 333
DdeI	CTNAG	2 cut(s)	27, 107
DpnI	GATC	1 cut(s)	223
DpnII	GATC	1 cut(s)	221
Eam1104I	CTCTTC	1 cut(s)	3
EarI	CTCTTC	1 cut(s)	3
Eco47I	GGWCC	1 cut(s)	77
EcoO109I	RGGNCCY	1 cut(s)	77
FaeI	CATG	2 cut(s)	46, 305
FaqI	GGGAC	1 cut(s)	53
FatI	CATG	2 cut(s)	42, 301
FauNDI	CATATG	2 cut(s)	56, 150
Fnu4HI	GCNGC	2 cut(s)	192, 309
Fsp4HI	GCNGC	2 cut(s)	192, 309
GluI	GCNGC	2 cut(s)	192, 309
Hin1II	CATG	2 cut(s)	46, 305
HinfI	GANTC	2 cut(s)	17, 298
HphI	GGTGA	2 cut(s)	76, 191
Hpy188I	TCNGA	1 cut(s)	22
Hpy188III	TCNNGA	1 cut(s)	80
HpyAV	CCTTC	1 cut(s)	131
HpyCH4V	TGCA	1 cut(s)	4
HpyF10VI	GCNNNNNNNGC	1 cut(s)	173
HpyF3I	CTNAG	2 cut(s)	27, 107
Hsp92II	CATG	2 cut(s)	46, 305
Kzo9I	GATC	1 cut(s)	221
LpnPI	CCDG	3 cut(s)	93, 143, 162
Lsp1109I	GCAGC	2 cut(s)	178, 295
MaeIII	GTNAC	1 cut(s)	244
MalI	GATC	1 cut(s)	223
MboI	GATC	1 cut(s)	221
MboII	GAAGA	1 cut(s)	20
MluCI	AATT	2 cut(s)	184, 277
MnlI	CCTC	4 cut(s)	16, 138, 277, 310
MseI	TTAA	1 cut(s)	321
MspA1I	CMGCKG	1 cut(s)	333
MwoI	GCNNNNNNNGC	1 cut(s)	173
NdeI	CATATG	2 cut(s)	56, 150
NdeII	GATC	1 cut(s)	221
NlaIII	CATG	2 cut(s)	46, 305
NmuCI	GTSAC	1 cut(s)	244
PfeI	GAWTC	2 cut(s)	17, 298
PkrI	GCNGC	2 cut(s)	193, 310
PpuMI	RGGWCCY	1 cut(s)	77
Psp5II	RGGWCCY	1 cut(s)	77
PspPI	GGNCC	1 cut(s)	77
PspPPI	RGGWCCY	1 cut(s)	77
PvuII	CAGCTG	1 cut(s)	333
SaqAI	TTAA	1 cut(s)	321
SatI	GCNGC	2 cut(s)	192, 309
Sau3AI	GATC	1 cut(s)	221
Sau96I	GGNCC	1 cut(s)	77
SetI	ASST	7 cut(s)	54, 79, 178, 288, 321, 328, 335
SfcI	CTRYAG	1 cut(s)	195
SgeI	CNNG	8 cut(s)	17, 55, 92, 154, 170, 185, 189, 314
SinI	GGWCC	1 cut(s)	77
Sse9I	AATT	2 cut(s)	184, 277
TasI	AATT	2 cut(s)	184, 277
TfiI	GAWTC	2 cut(s)	17, 298
Tru1I	TTAA	1 cut(s)	321
Tru9I	TTAA	1 cut(s)	321
TseFI	GTSAC	1 cut(s)	244
TseI	GCWGC	2 cut(s)	191, 308
Tsp45I	GTSAC	1 cut(s)	244
TspDTI	ATGAA	3 cut(s)	150, 252, 290
VpaK11BI	GGWCC	1 cut(s)	77

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.