Rmu_sc0001516.1_g000076

palmitoyl-(protein) hydrolase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001516.1
Physical Location & Seq
Reverse (-)
280233 .. 281439
1207 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001516.1_g000076.1.cds

Sequence Viewer

Length: 555 bp
atgggtttttggtggtttagggctcgtgagttgttctactatttgaaaggtgggcgggtcgattatggtgaagaacacagcaaagcctgtgggcattcccagtttggccgtctgtatgaacaagggcactaccctgaatgggatgaggatcatcctattcactttgtgggccattccgccggagctcaggtcgtccgtgttctgcagcaaatgcttgctgataaggctttcaaggggtatgagaatactaacgagaattgggtattgagcatcacatcattgtccggagcgttcaatgggactacaagaacttacttggatggaatgcagcctgaggatggcaaaaccctaaagcccatatgtctgctgcaactatgtcgcataggagtgattatttatgactggctagacatttcctggctaaaggaatattacaactttgggtttgatcactataatatcacatggaagaaagtcggtgtttggggtctcattgattgcctcttgggaaattcgggaccattcgctttttggttgcaatcttatattttttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

184

Amino Acids

21.44

Weight (kDa)

5.94

Isoelectric Point (pI)

29.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 284
AciI CCGC 2 cut(s) 55, 177
AclWI GGATC 1 cut(s) 156
AcoI YGGCCR 1 cut(s) 106
AcsI RAATTY 1 cut(s) 511
AdeI CACNNNGTG 1 cut(s) 166
AfiI CCNNNNNNNGG 2 cut(s) 139, 338
AgsI TTSAA 3 cut(s) 46, 232, 295
AjnI CCWGG 1 cut(s) 416
AluBI AGCT 1 cut(s) 185
AluI AGCT 1 cut(s) 185
Alw21I GWGCWC 1 cut(s) 187
Alw26I GTCTC 1 cut(s) 494
AlwI GGATC 1 cut(s) 156
Aor13HI TCCGGA 1 cut(s) 284
AoxI GGCC 2 cut(s) 106, 169
ApeKI GCWGC 3 cut(s) 205, 328, 367
ApoI RAATTY 1 cut(s) 511
AspS9I GGNCC 2 cut(s) 169, 518
AsuHPI GGTGA 1 cut(s) 80
AvaII GGWCC 1 cut(s) 518
AxyI CCTNAGG 1 cut(s) 333
BaeGI GKGCMC 1 cut(s) 129
BanII GRGCYC 2 cut(s) 25, 187
BauI CACGAG 1 cut(s) 24
Bbv12I GWGCWC 1 cut(s) 187
BbvI GCAGC 3 cut(s) 217, 340, 354
BccI CCATC 2 cut(s) 314, 332
BceAI ACGGC 1 cut(s) 93
BcgI CGANNNNNNTGC 2 cut(s) 359, 393
BciT130I CCWGG 1 cut(s) 418
BclI TGATCA 1 cut(s) 448
BcoDI GTCTC 1 cut(s) 494
BfaI CTAG 1 cut(s) 407
BfmI CTRYAG 1 cut(s) 203
BisI GCNGC 3 cut(s) 206, 329, 368
BlsI GCNGC 3 cut(s) 207, 330, 369
Bme1390I CCNGG 1 cut(s) 418
Bme18I GGWCC 1 cut(s) 518
BmgT120I GGNCC 2 cut(s) 169, 518
BmiI GGNNCC 1 cut(s) 519
BmrFI CCNGG 1 cut(s) 418
BmrI ACTGGG 1 cut(s) 94
BmsI GCATC 1 cut(s) 279
BmuI ACTGGG 1 cut(s) 94
Bpu10I CCTNAGC 1 cut(s) 186
BsaBI GATNNNNATC 1 cut(s) 147
BsaI GGTCTC 1 cut(s) 494
BsaWI WCCGGW 1 cut(s) 284
BsaXI ACNNNNNCTCC 2 cut(s) 174, 204
Bsc4I CCNNNNNNNGG 2 cut(s) 139, 338
Bse1I ACTGG 2 cut(s) 100, 407
Bse21I CCTNAGG 1 cut(s) 333
Bse8I GATNNNNATC 1 cut(s) 147
BseAI TCCGGA 1 cut(s) 284
BseBI CCWGG 1 cut(s) 418
BseGI GGATG 4 cut(s) 148, 151, 325, 343
BseJI GATNNNNATC 1 cut(s) 147
BseLI CCNNNNNNNGG 2 cut(s) 139, 338
BseMII CTCAG 2 cut(s) 200, 324
BseNI ACTGG 2 cut(s) 100, 407
BseSI GKGCMC 1 cut(s) 129
BseXI GCAGC 3 cut(s) 217, 340, 354
BshFI GGCC 2 cut(s) 108, 171
BsiHKAI GWGCWC 1 cut(s) 187
BsiSI CCGG 2 cut(s) 180, 285
BslFI GGGAC 2 cut(s) 313, 531
BslI CCNNNNNNNGG 2 cut(s) 139, 338
BsmAI GTCTC 1 cut(s) 494
BsmFI GGGAC 2 cut(s) 313, 531
BsmI GAATGC 2 cut(s) 94, 330
BsnI GGCC 2 cut(s) 108, 171
Bso31I GGTCTC 1 cut(s) 494
Bsp1286I GDGCHC 3 cut(s) 25, 129, 187
Bsp13I TCCGGA 1 cut(s) 284
Bsp143I GATC 2 cut(s) 148, 448
BspACI CCGC 2 cut(s) 55, 177
BspANI GGCC 2 cut(s) 108, 171
BspCNI CTCAG 2 cut(s) 199, 325
BspEI TCCGGA 1 cut(s) 284
BspLI GGNNCC 1 cut(s) 519
BspMAI CTGCAG 1 cut(s) 207
BspPI GGATC 1 cut(s) 156
BspTNI GGTCTC 1 cut(s) 494
BsrI ACTGG 2 cut(s) 100, 407
BssMI GATC 2 cut(s) 148, 448
BssSI CACGAG 1 cut(s) 24
Bst2BI CACGAG 1 cut(s) 24
Bst2UI CCWGG 1 cut(s) 418
BstAPI GCANNNNNTGC 1 cut(s) 211
BstC8I GCNNGC 1 cut(s) 216
BstDEI CTNAG 2 cut(s) 186, 333
BstF5I GGATG 4 cut(s) 148, 151, 325, 343
BstKTI GATC 2 cut(s) 151, 451
BstMAI GTCTC 1 cut(s) 494
BstMBI GATC 2 cut(s) 148, 448
BstMWI GCNNNNNNNGC 2 cut(s) 211, 224
BstNI CCWGG 1 cut(s) 418
BstSCI CCNGG 1 cut(s) 416
BstSFI CTRYAG 1 cut(s) 203
BstSLI GKGCMC 1 cut(s) 129
BstV1I GCAGC 3 cut(s) 217, 340, 354
Bsu36I CCTNAGG 1 cut(s) 333
BsuRI GGCC 2 cut(s) 108, 171
BtsCI GGATG 4 cut(s) 148, 151, 325, 343
Cac8I GCNNGC 1 cut(s) 216
Cfr13I GGNCC 2 cut(s) 169, 518
CspCI CAANNNNNGTGG 2 cut(s) 70, 105
CviAII CATG 1 cut(s) 465
DdeI CTNAG 2 cut(s) 186, 333
DpnI GATC 2 cut(s) 150, 450
DpnII GATC 2 cut(s) 148, 448
DraIII CACNNNGTG 1 cut(s) 166
EaeI YGGCCR 1 cut(s) 106
EciI GGCGGA 1 cut(s) 166
Ecl136II GAGCTC 1 cut(s) 185
Eco24I GRGCYC 2 cut(s) 25, 187
Eco31I GGTCTC 1 cut(s) 494
Eco47I GGWCC 1 cut(s) 518
Eco53kI GAGCTC 1 cut(s) 185
Eco81I CCTNAGG 1 cut(s) 333
EcoICRI GAGCTC 1 cut(s) 185
EcoRII CCWGG 1 cut(s) 416
EcoT38I GRGCYC 2 cut(s) 25, 187
FaeI CATG 1 cut(s) 468
FaqI GGGAC 2 cut(s) 313, 531
FatI CATG 1 cut(s) 464
FauI CCCGC 1 cut(s) 48
FauNDI CATATG 1 cut(s) 359
FbaI TGATCA 1 cut(s) 448
Fnu4HI GCNGC 3 cut(s) 206, 329, 368
FokI GGATG 4 cut(s) 138, 155, 332, 350
FriOI GRGCYC 2 cut(s) 25, 187
Fsp4HI GCNGC 3 cut(s) 206, 329, 368
FspBI CTAG 1 cut(s) 407
GluI GCNGC 3 cut(s) 206, 329, 368
HaeIII GGCC 2 cut(s) 108, 171
HapII CCGG 2 cut(s) 180, 285
Hin1II CATG 1 cut(s) 468
HpaII CCGG 2 cut(s) 180, 285
HphI GGTGA 1 cut(s) 80
Hpy188III TCNNGA 3 cut(s) 26, 285, 516
HpyCH4V TGCA 4 cut(s) 205, 328, 370, 538
HpyF10VI GCNNNNNNNGC 2 cut(s) 211, 224
HpyF3I CTNAG 2 cut(s) 186, 333
Hsp92II CATG 1 cut(s) 468
Kpn2I TCCGGA 1 cut(s) 284
Ksp22I TGATCA 1 cut(s) 448
Kzo9I GATC 2 cut(s) 148, 448
LmnI GCTCC 2 cut(s) 182, 287
Lsp1109I GCAGC 3 cut(s) 217, 340, 354
LweI GCATC 1 cut(s) 279
MaeI CTAG 1 cut(s) 407
MalI GATC 2 cut(s) 150, 450
MboI GATC 2 cut(s) 148, 448
MboII GAAGA 2 cut(s) 83, 481
MhlI GDGCHC 3 cut(s) 25, 129, 187
MluCI AATT 2 cut(s) 256, 511
MnlI CCTC 3 cut(s) 139, 328, 512
MroI TCCGGA 1 cut(s) 284
MslI CAYNNNNRTG 1 cut(s) 386
MspI CCGG 2 cut(s) 180, 285
MspR9I CCNGG 1 cut(s) 418
Mva1269I GAATGC 2 cut(s) 94, 330
MvaI CCWGG 1 cut(s) 418
MwoI GCNNNNNNNGC 2 cut(s) 211, 224
NdeI CATATG 1 cut(s) 359
NdeII GATC 2 cut(s) 148, 448
NlaIII CATG 1 cut(s) 468
NlaIV GGNNCC 1 cut(s) 519
PctI GAATGC 2 cut(s) 94, 330
PkrI GCNGC 3 cut(s) 207, 330, 369
Psp124BI GAGCTC 1 cut(s) 187
Psp6I CCWGG 1 cut(s) 416
PspGI CCWGG 1 cut(s) 416
PspN4I GGNNCC 1 cut(s) 519
PspPI GGNCC 2 cut(s) 169, 518
PstI CTGCAG 1 cut(s) 207
RseI CAYNNNNRTG 1 cut(s) 386
SacI GAGCTC 1 cut(s) 187
SatI GCNGC 3 cut(s) 206, 329, 368
Sau3AI GATC 2 cut(s) 148, 448
Sau96I GGNCC 2 cut(s) 169, 518
ScrFI CCNGG 1 cut(s) 418
SduI GDGCHC 3 cut(s) 25, 129, 187
SetI ASST 3 cut(s) 52, 187, 192
SfaNI GCATC 1 cut(s) 279
SfcI CTRYAG 1 cut(s) 203
SinI GGWCC 1 cut(s) 518
SmiMI CAYNNNNRTG 1 cut(s) 386
Sse9I AATT 2 cut(s) 256, 511
SsiI CCGC 2 cut(s) 55, 177
SspI AATATT 1 cut(s) 431
SspMI CTAG 1 cut(s) 407
SstI GAGCTC 1 cut(s) 187
StyD4I CCNGG 1 cut(s) 416
TaqI TCGA 1 cut(s) 60
TasI AATT 2 cut(s) 256, 511
TseI GCWGC 3 cut(s) 205, 328, 367
TspDTI ATGAA 1 cut(s) 132
TspGWI ACGGA 1 cut(s) 185
VpaK11BI GGWCC 1 cut(s) 518
XapI RAATTY 1 cut(s) 511
XcmI CCANNNNNNNNNTGG 1 cut(s) 528
XspI CTAG 1 cut(s) 407
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.