Rmu_sc0001643.1_g000002

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001643.1
OG0007114
Physical Location & Seq
Forward (+)
2577 .. 7098
4522 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001643.1_g000002.1.cds

Sequence Viewer

Length: 477 bp
atggagtattgtggtggagatgttctcaactccatacccgatatcttagaagcaggagtatgggaagatggagattgtggtggagcagaattcgaggatgtgaagcaatttaagaaggagctttccgttgagcattcactggggtttaaattgccagaatctttgaaactgaagctaaccaatgaaataattgacgagttgaagaatttgcctctcaaggcaaatgtcagtgagcaaagagatgaagttttgctaggcaggcctcttccacctgaatgccacgctgaacttcatacagattatgatggtgttgctgtaagatggggccttaaccaccacaatgaaagtgcagctgactgttgtcaggcttgcttagttcaagcaaaacatgccaagcctaatgaaaagaaatgtaatatatgggtttactgtcctgcagaagatggttgccattctccagatatctatgaaaactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PAN_4

Protein Analysis

158

Amino Acids

17.63

Weight (kDa)

4.73

Isoelectric Point (pI)

44.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 89, 205
AcuI CTGAAG 1 cut(s) 191
AgsI TTSAA 3 cut(s) 166, 202, 380
AluBI AGCT 3 cut(s) 121, 175, 353
AluI AGCT 3 cut(s) 121, 175, 353
AoxI GGCC 2 cut(s) 260, 325
ApeKI GCWGC 1 cut(s) 350
ApoI RAATTY 2 cut(s) 89, 205
AspS9I GGNCC 1 cut(s) 325
BbvI GCAGC 1 cut(s) 362
BccI CCATC 4 cut(s) 62, 299, 315, 437
BfaI CTAG 1 cut(s) 254
BfmI CTRYAG 1 cut(s) 435
BisI GCNGC 1 cut(s) 351
BlsI GCNGC 1 cut(s) 352
BmgT120I GGNCC 1 cut(s) 325
BmiI GGNNCC 1 cut(s) 326
BmrI ACTGGG 1 cut(s) 149
BmuI ACTGGG 1 cut(s) 149
BoxI GACNNNNGTC 1 cut(s) 360
BplI GAGNNNNNCTC 2 cut(s) 9, 41
BpmI CTGGAG 1 cut(s) 441
BpuEI CTTGAG 1 cut(s) 200
Bse1I ACTGG 1 cut(s) 144
BseGI GGATG 1 cut(s) 103
BseNI ACTGG 1 cut(s) 144
BseXI GCAGC 1 cut(s) 362
BsgI GTGCAG 1 cut(s) 369
BshFI GGCC 2 cut(s) 262, 327
BsmI GAATGC 2 cut(s) 133, 281
BsnI GGCC 2 cut(s) 262, 327
BspANI GGCC 2 cut(s) 262, 327
BspLI GGNNCC 1 cut(s) 326
BspMAI CTGCAG 1 cut(s) 439
BsrI ACTGG 1 cut(s) 144
Bst4CI ACNGT 2 cut(s) 359, 431
Bst6I CTCTTC 1 cut(s) 270
BstAPI GCANNNNNTGC 1 cut(s) 389
BstC8I GCNNGC 2 cut(s) 260, 370
BstDEI CTNAG 2 cut(s) 46, 373
BstF5I GGATG 1 cut(s) 103
BstMWI GCNNNNNNNGC 2 cut(s) 259, 389
BstNSI RCATGY 1 cut(s) 392
BstPAI GACNNNNGTC 1 cut(s) 360
BstSFI CTRYAG 1 cut(s) 435
BstV1I GCAGC 1 cut(s) 362
BsuRI GGCC 2 cut(s) 262, 327
BtsCI GGATG 1 cut(s) 103
BtsIMutI CAGTG 2 cut(s) 137, 235
Cac8I GCNNGC 2 cut(s) 260, 370
Cfr13I GGNCC 1 cut(s) 325
CviAII CATG 1 cut(s) 389
CviJI RGCY 7 cut(s) 121, 175, 262, 327, 353, 368, 397
CviKI_1 RGCY 7 cut(s) 121, 175, 262, 327, 353, 368, 397
DdeI CTNAG 2 cut(s) 46, 373
DraI TTTAAA 1 cut(s) 148
Eam1104I CTCTTC 1 cut(s) 270
EarI CTCTTC 1 cut(s) 270
Eco147I AGGCCT 1 cut(s) 262
Eco32I GATATC 2 cut(s) 43, 463
Eco57I CTGAAG 1 cut(s) 191
EcoO109I RGGNCCY 1 cut(s) 325
EcoRI GAATTC 1 cut(s) 89
EcoRV GATATC 2 cut(s) 43, 463
FaeI CATG 1 cut(s) 392
FaiI YATR 8 cut(s) 35, 61, 294, 303, 390, 419, 421, 468
FatI CATG 1 cut(s) 388
Fnu4HI GCNGC 1 cut(s) 351
FokI GGATG 1 cut(s) 110
Fsp4HI GCNGC 1 cut(s) 351
FspBI CTAG 1 cut(s) 254
GluI GCNGC 1 cut(s) 351
GsuI CTGGAG 1 cut(s) 441
HaeIII GGCC 2 cut(s) 262, 327
Hin1II CATG 1 cut(s) 392
HinfI GANTC 1 cut(s) 158
Hpy166II GTNNAC 1 cut(s) 427
Hpy188III TCNNGA 1 cut(s) 458
Hpy8I GTNNAC 1 cut(s) 427
HpyAV CCTTC 1 cut(s) 109
HpyCH4III ACNGT 2 cut(s) 359, 431
HpyCH4V TGCA 2 cut(s) 350, 437
HpyF10VI GCNNNNNNNGC 2 cut(s) 259, 389
HpyF3I CTNAG 2 cut(s) 46, 373
Hsp92II CATG 1 cut(s) 392
LmnI GCTCC 2 cut(s) 83, 118
LpnPI CCDG 8 cut(s) 39, 125, 168, 244, 285, 350, 447, 471
Lsp1109I GCAGC 1 cut(s) 362
MaeI CTAG 1 cut(s) 254
MboII GAAGA 4 cut(s) 77, 214, 257, 452
MluCI AATT 5 cut(s) 89, 107, 149, 189, 205
MnlI CCTC 3 cut(s) 88, 222, 273
MseI TTAA 3 cut(s) 111, 147, 330
MslI CAYNNNNRTG 2 cut(s) 274, 339
MspA1I CMGCKG 1 cut(s) 353
Mva1269I GAATGC 2 cut(s) 133, 281
MwoI GCNNNNNNNGC 2 cut(s) 259, 389
NlaIII CATG 1 cut(s) 392
NlaIV GGNNCC 1 cut(s) 326
NspI RCATGY 1 cut(s) 392
PceI AGGCCT 1 cut(s) 262
PctI GAATGC 2 cut(s) 133, 281
PfeI GAWTC 1 cut(s) 158
PkrI GCNGC 1 cut(s) 352
PshAI GACNNNNGTC 1 cut(s) 360
PspN4I GGNNCC 1 cut(s) 326
PspPI GGNCC 1 cut(s) 325
PstI CTGCAG 1 cut(s) 439
PvuII CAGCTG 1 cut(s) 353
RseI CAYNNNNRTG 2 cut(s) 274, 339
SaqAI TTAA 3 cut(s) 111, 147, 330
SatI GCNGC 1 cut(s) 351
Sau96I GGNCC 1 cut(s) 325
SetI ASST 4 cut(s) 123, 177, 274, 355
SfcI CTRYAG 1 cut(s) 435
SmiMI CAYNNNNRTG 2 cut(s) 274, 339
SmlI CTYRAG 1 cut(s) 215
SmoI CTYRAG 1 cut(s) 215
Sse9I AATT 5 cut(s) 89, 107, 149, 189, 205
SseBI AGGCCT 1 cut(s) 262
SspMI CTAG 1 cut(s) 254
StuI AGGCCT 1 cut(s) 262
TaaI ACNGT 2 cut(s) 359, 431
TaqI TCGA 1 cut(s) 93
TasI AATT 5 cut(s) 89, 107, 149, 189, 205
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 3 cut(s) 111, 147, 330
Tru9I TTAA 3 cut(s) 111, 147, 330
TscAI CASTG 2 cut(s) 144, 235
TseI GCWGC 1 cut(s) 350
TspDTI ATGAA 5 cut(s) 198, 258, 281, 357, 417
TspGWI ACGGA 1 cut(s) 115
TspRI CASTG 2 cut(s) 144, 235
XapI RAATTY 2 cut(s) 89, 205
XceI RCATGY 1 cut(s) 392
XspI CTAG 1 cut(s) 254
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.