Rmu_sc0001986.1_g000024

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001986.1
OG0014876
Physical Location & Seq
Reverse (-)
91586 .. 92020
435 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001986.1_g000024.1.cds

Sequence Viewer

Length: 435 bp
ctggatacgattctcgagcctagccaggaagtgctaactattgagcaagctcaagctttggaagcaaatatagcagccttggaagccaataaggcgaaagccatcatcctaatgacttgtcatatggatgattcgcttcagtacaagtatatgaatgaagaagaccccaaaaagttgtgggtctcactcgaagaaagatttggcaacgtccgtaactccctgcttcctgacctagaagtgagatggcatagcctctgcttctgtgatttcaagtcagttcttgactacaactcggaagcacttcgcattaaatccttaatggaattctatggaaaagagatcacagatgcgatgctaattgagaggattcactctaccttccccgtttcttcttttatggttgctaagaactatcgaatcgatgttactgcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

144

Amino Acids

16.61

Weight (kDa)

4.86

Isoelectric Point (pI)

58.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 323
AcuI CTGAAG 1 cut(s) 122
AfaI GTAC 1 cut(s) 143
AgsI TTSAA 1 cut(s) 271
AjnI CCWGG 1 cut(s) 24
AjuI GAANNNNNNNTTGG 2 cut(s) 183, 215
AluBI AGCT 2 cut(s) 50, 56
AluI AGCT 2 cut(s) 50, 56
Alw26I GTCTC 1 cut(s) 187
Ama87I CYCGRG 1 cut(s) 14
ApeKI GCWGC 1 cut(s) 74
ApoI RAATTY 1 cut(s) 323
Asp700I GAANNNNTTC 1 cut(s) 300
AvaI CYCGRG 1 cut(s) 14
BbsI GAAGAC 1 cut(s) 168
BbvI GCAGC 1 cut(s) 86
BccI CCATC 2 cut(s) 110, 237
BcgI CGANNNNNNTGC 1 cut(s) 410
BciT130I CCWGG 1 cut(s) 26
BcoDI GTCTC 1 cut(s) 187
BfaI CTAG 2 cut(s) 21, 233
BglI GCCNNNNNGGC 1 cut(s) 92
BisI GCNGC 1 cut(s) 75
BlsI GCNGC 1 cut(s) 76
Bme1390I CCNGG 1 cut(s) 26
BmeT110I CYCGRG 1 cut(s) 14
BmrFI CCNGG 1 cut(s) 26
BmsI GCATC 2 cut(s) 337, 342
BpiI GAAGAC 1 cut(s) 168
BpuEI CTTGAG 1 cut(s) 36
Bsa29I ATCGAT 1 cut(s) 420
BsaI GGTCTC 1 cut(s) 187
BsaJI CCNNGG 1 cut(s) 78
BseBI CCWGG 1 cut(s) 26
BseCI ATCGAT 1 cut(s) 420
BseDI CCNNGG 1 cut(s) 78
BseGI GGATG 2 cut(s) 105, 133
BseXI GCAGC 1 cut(s) 86
BshVI ATCGAT 1 cut(s) 420
BsiHKCI CYCGRG 1 cut(s) 14
BsmAI GTCTC 1 cut(s) 187
Bso31I GGTCTC 1 cut(s) 187
BsoBI CYCGRG 1 cut(s) 14
Bsp143I GATC 1 cut(s) 339
BspDI ATCGAT 1 cut(s) 420
BspTNI GGTCTC 1 cut(s) 187
BssECI CCNNGG 1 cut(s) 78
BssMI GATC 1 cut(s) 339
BssT1I CCWWGG 1 cut(s) 78
Bst2UI CCWGG 1 cut(s) 26
BstC8I GCNNGC 1 cut(s) 48
BstDEI CTNAG 1 cut(s) 405
BstF5I GGATG 2 cut(s) 105, 133
BstKTI GATC 1 cut(s) 342
BstMAI GTCTC 1 cut(s) 187
BstMBI GATC 1 cut(s) 339
BstMWI GCNNNNNNNGC 4 cut(s) 62, 71, 83, 92
BstNI CCWGG 1 cut(s) 26
BstSCI CCNGG 1 cut(s) 24
BstV1I GCAGC 1 cut(s) 86
BstV2I GAAGAC 1 cut(s) 168
Bsu15I ATCGAT 1 cut(s) 420
BsuTUI ATCGAT 1 cut(s) 420
BtgZI GCGATG 1 cut(s) 365
BtsCI GGATG 2 cut(s) 105, 133
Cac8I GCNNGC 1 cut(s) 48
ClaI ATCGAT 1 cut(s) 420
Csp6I GTAC 1 cut(s) 142
CviAII CATG 1 cut(s) 432
CviJI RGCY 8 cut(s) 19, 24, 50, 56, 77, 86, 101, 252
CviKI_1 RGCY 8 cut(s) 19, 24, 50, 56, 77, 86, 101, 252
CviQI GTAC 1 cut(s) 142
DdeI CTNAG 1 cut(s) 405
DpnI GATC 1 cut(s) 341
DpnII GATC 1 cut(s) 339
Eco130I CCWWGG 1 cut(s) 78
Eco31I GGTCTC 1 cut(s) 187
Eco57I CTGAAG 1 cut(s) 122
Eco88I CYCGRG 1 cut(s) 14
EcoRI GAATTC 1 cut(s) 323
EcoRII CCWGG 1 cut(s) 24
EcoT14I CCWWGG 1 cut(s) 78
ErhI CCWWGG 1 cut(s) 78
FaeI CATG 1 cut(s) 435
FaiI YATR 9 cut(s) 71, 123, 125, 150, 152, 249, 330, 398, 433
FatI CATG 1 cut(s) 431
FauNDI CATATG 1 cut(s) 123
Fnu4HI GCNGC 1 cut(s) 75
FokI GGATG 2 cut(s) 92, 140
Fsp4HI GCNGC 1 cut(s) 75
FspBI CTAG 2 cut(s) 21, 233
GluI GCNGC 1 cut(s) 75
Hin1II CATG 1 cut(s) 435
HindIII AAGCTT 1 cut(s) 54
HinfI GANTC 4 cut(s) 10, 131, 367, 417
Hpy188I TCNGA 1 cut(s) 295
Hpy188III TCNNGA 3 cut(s) 14, 227, 281
HpyAV CCTTC 1 cut(s) 388
HpyCH4IV ACGT 1 cut(s) 207
HpyCH4V TGCA 1 cut(s) 431
HpyF10VI GCNNNNNNNGC 4 cut(s) 62, 71, 83, 92
HpyF3I CTNAG 1 cut(s) 405
HpySE526I ACGT 1 cut(s) 207
Hsp92II CATG 1 cut(s) 435
Kzo9I GATC 1 cut(s) 339
LpnPI CCDG 4 cut(s) 11, 38, 233, 240
Lsp1109I GCAGC 1 cut(s) 86
LweI GCATC 2 cut(s) 337, 342
MaeI CTAG 2 cut(s) 21, 233
MaeII ACGT 1 cut(s) 207
MaeIII GTNAC 2 cut(s) 212, 424
MalI GATC 1 cut(s) 341
MboI GATC 1 cut(s) 339
MboII GAAGA 4 cut(s) 170, 173, 203, 381
MluCI AATT 2 cut(s) 323, 357
MnlI CCTC 2 cut(s) 263, 357
MroXI GAANNNNTTC 1 cut(s) 300
MseI TTAA 2 cut(s) 309, 317
MslI CAYNNNNRTG 2 cut(s) 110, 126
MspR9I CCNGG 1 cut(s) 26
MvaI CCWGG 1 cut(s) 26
MwoI GCNNNNNNNGC 4 cut(s) 62, 71, 83, 92
NdeI CATATG 1 cut(s) 123
NdeII GATC 1 cut(s) 339
NlaIII CATG 1 cut(s) 435
PaeR7I CTCGAG 1 cut(s) 14
PdmI GAANNNNTTC 1 cut(s) 300
PfeI GAWTC 4 cut(s) 10, 131, 367, 417
PkrI GCNGC 1 cut(s) 76
Psp6I CCWGG 1 cut(s) 24
PspGI CCWGG 1 cut(s) 24
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
RseI CAYNNNNRTG 2 cut(s) 110, 126
SaqAI TTAA 2 cut(s) 309, 317
SatI GCNGC 1 cut(s) 75
Sau3AI GATC 1 cut(s) 339
ScrFI CCNGG 1 cut(s) 26
SetI ASST 5 cut(s) 52, 58, 210, 234, 380
SfaNI GCATC 2 cut(s) 337, 342
Sfr274I CTCGAG 1 cut(s) 14
SlaI CTCGAG 1 cut(s) 14
SmiMI CAYNNNNRTG 2 cut(s) 110, 126
SmlI CTYRAG 2 cut(s) 14, 51
SmoI CTYRAG 2 cut(s) 14, 51
Sse9I AATT 2 cut(s) 323, 357
SspMI CTAG 2 cut(s) 21, 233
StyD4I CCNGG 1 cut(s) 24
StyI CCWWGG 1 cut(s) 78
TaiI ACGT 1 cut(s) 210
TaqI TCGA 4 cut(s) 15, 189, 415, 420
TasI AATT 2 cut(s) 323, 357
TatI WGTACW 1 cut(s) 141
TfiI GAWTC 4 cut(s) 10, 131, 367, 417
Tru1I TTAA 2 cut(s) 309, 317
Tru9I TTAA 2 cut(s) 309, 317
TseI GCWGC 1 cut(s) 74
TspDTI ATGAA 2 cut(s) 167, 171
TspGWI ACGGA 1 cut(s) 200
XapI RAATTY 1 cut(s) 323
XhoI CTCGAG 1 cut(s) 14
XmnI GAANNNNTTC 1 cut(s) 300
XspI CTAG 2 cut(s) 21, 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.