Rmu_sc0002072.1_g000028

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002072.1
Physical Location & Seq
Reverse (-)
103923 .. 106749
2827 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002072.1_g000028.1.cds

Sequence Viewer

Length: 633 bp
atgaacaatgaggctcccaaatacttggtagtggcacaaagttcaacaccagatttggtagtagaaagtgcatgccttgatgacttatcaactagtgaggagtctgaagtactagactggccatttggagacaatgtggatcggagtccagattgctcatacggttcaatctccgacgagaaaagcctcatcgaaatatccctccccgacggatattatgttggccatgacaaggaagaagagtccatctttagtctgcaacagaaaatgtcagatgatcgttaccagattagaatctacactgtacgtaagattcaatacggtgaagagatcacattggactacaactctattaaggagagtaaggaagaatatgaagcatcagattgtttttgcggcagtcaagtttgccggggaggttacctgaatttgataagcgaaggatcattcttggaggatcgaacatatgctgcatatgctgcacaagatggaaattggattgctcgtattgcaacattgcttgtgggtaattttgagtctaaaaaggcaggcaaggaggaaatggcgcagaaatgccaagaaatggagaaacgaagttttcccaatcctattaggagaaggaatcccagttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

210

Amino Acids

23.82

Weight (kDa)

4.5

Isoelectric Point (pI)

56.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 583
AciI CCGC 1 cut(s) 396
AclWI GGATC 3 cut(s) 147, 451, 465
AcoI YGGCCR 2 cut(s) 119, 223
AcsI RAATTY 1 cut(s) 427
AcuI CTGAAG 1 cut(s) 126
AfaI GTAC 2 cut(s) 111, 306
AfiI CCNNNNNNNGG 2 cut(s) 232, 583
AgsI TTSAA 3 cut(s) 45, 168, 317
AhlI ACTAGT 1 cut(s) 92
Alw26I GTCTC 1 cut(s) 123
AlwI GGATC 3 cut(s) 147, 451, 465
AoxI GGCC 2 cut(s) 119, 223
ApeKI GCWGC 2 cut(s) 470, 479
ApoI RAATTY 1 cut(s) 427
ArsI GACNNNNNNTTYG 2 cut(s) 107, 139
AspLEI GCGC 1 cut(s) 568
AsuC2I CCSGG 1 cut(s) 413
AsuHPI GGTGA 1 cut(s) 335
BalI TGGCCA 2 cut(s) 121, 225
BbvI GCAGC 2 cut(s) 457, 466
BccI CCATC 2 cut(s) 254, 482
BcnI CCSGG 1 cut(s) 413
BcoDI GTCTC 1 cut(s) 123
BcuI ACTAGT 1 cut(s) 92
BfaI CTAG 2 cut(s) 93, 113
BisI GCNGC 3 cut(s) 397, 471, 480
BlsI GCNGC 3 cut(s) 398, 472, 481
BmcAI AGTACT 1 cut(s) 111
Bme1390I CCNGG 1 cut(s) 413
BmiI GGNNCC 1 cut(s) 15
BmrFI CCNGG 1 cut(s) 413
BmrI ACTGGG 1 cut(s) 621
BmsI GCATC 1 cut(s) 389
BmuI ACTGGG 1 cut(s) 621
BpuMI CCSGG 1 cut(s) 413
BsaAI YACGTR 1 cut(s) 308
BsaBI GATNNNNATC 1 cut(s) 293
BsaJI CCNNGG 1 cut(s) 412
BsaXI ACNNNNNCTCC 2 cut(s) 120, 150
Bsc4I CCNNNNNNNGG 2 cut(s) 232, 583
Bse1I ACTGG 2 cut(s) 122, 627
Bse3DI GCAATG 1 cut(s) 515
Bse8I GATNNNNATC 1 cut(s) 293
BseDI CCNNGG 1 cut(s) 412
BseJI GATNNNNATC 1 cut(s) 293
BseLI CCNNNNNNNGG 2 cut(s) 232, 583
BseMI GCAATG 1 cut(s) 515
BseNI ACTGG 2 cut(s) 122, 627
BseRI GAGGAG 1 cut(s) 113
BseXI GCAGC 2 cut(s) 457, 466
BsgI GTGCAG 1 cut(s) 465
BshFI GGCC 2 cut(s) 121, 225
BsiSI CCGG 1 cut(s) 412
BslI CCNNNNNNNGG 2 cut(s) 232, 583
BsmAI GTCTC 1 cut(s) 123
BsnI GGCC 2 cut(s) 121, 225
Bsp143I GATC 5 cut(s) 139, 277, 330, 443, 457
BspACI CCGC 1 cut(s) 396
BspANI GGCC 2 cut(s) 121, 225
BspLI GGNNCC 1 cut(s) 15
BspPI GGATC 3 cut(s) 147, 451, 465
BsrDI GCAATG 1 cut(s) 515
BsrI ACTGG 2 cut(s) 122, 627
BssECI CCNNGG 1 cut(s) 412
BssMI GATC 5 cut(s) 139, 277, 330, 443, 457
Bst4CI ACNGT 3 cut(s) 164, 304, 323
Bst6I CTCTTC 2 cut(s) 234, 321
BstAPI GCANNNNNTGC 1 cut(s) 479
BstBAI YACGTR 1 cut(s) 308
BstC8I GCNNGC 2 cut(s) 73, 550
BstEII GGTNACC 1 cut(s) 419
BstHHI GCGC 1 cut(s) 568
BstKTI GATC 5 cut(s) 142, 280, 333, 446, 460
BstMAI GTCTC 1 cut(s) 123
BstMBI GATC 5 cut(s) 139, 277, 330, 443, 457
BstMWI GCNNNNNNNGC 3 cut(s) 476, 479, 509
BstNSI RCATGY 1 cut(s) 75
BstPI GGTNACC 1 cut(s) 419
BstSCI CCNGG 1 cut(s) 411
BstSNI TACGTA 1 cut(s) 308
BstV1I GCAGC 2 cut(s) 457, 466
BstXI CCANNNNNNTGG 1 cut(s) 25
BsuRI GGCC 2 cut(s) 121, 225
BtsIMutI CAGTG 1 cut(s) 300
Cac8I GCNNGC 2 cut(s) 73, 550
CfoI GCGC 1 cut(s) 568
Csp6I GTAC 2 cut(s) 110, 305
CviAII CATG 2 cut(s) 72, 227
CviJI RGCY 4 cut(s) 14, 121, 186, 225
CviKI_1 RGCY 4 cut(s) 14, 121, 186, 225
CviQI GTAC 2 cut(s) 110, 305
DpnI GATC 5 cut(s) 141, 279, 332, 445, 459
DpnII GATC 5 cut(s) 139, 277, 330, 443, 457
EaeI YGGCCR 2 cut(s) 119, 223
Eam1104I CTCTTC 2 cut(s) 234, 321
EarI CTCTTC 2 cut(s) 234, 321
Eco105I TACGTA 1 cut(s) 308
Eco57I CTGAAG 1 cut(s) 126
Eco91I GGTNACC 1 cut(s) 419
EcoO65I GGTNACC 1 cut(s) 419
FaeI CATG 2 cut(s) 75, 230
FaiI YATR 9 cut(s) 73, 160, 219, 228, 375, 466, 468, 475, 477
FatI CATG 2 cut(s) 71, 226
FauNDI CATATG 2 cut(s) 466, 475
Fnu4HI GCNGC 3 cut(s) 397, 471, 480
Fsp4HI GCNGC 3 cut(s) 397, 471, 480
FspBI CTAG 2 cut(s) 93, 113
GlaI GCGC 1 cut(s) 567
GluI GCNGC 3 cut(s) 397, 471, 480
HaeIII GGCC 2 cut(s) 121, 225
HapII CCGG 1 cut(s) 412
HhaI GCGC 1 cut(s) 568
Hin1II CATG 2 cut(s) 75, 230
Hin6I GCGC 1 cut(s) 566
HinP1I GCGC 1 cut(s) 566
HinfI GANTC 7 cut(s) 101, 145, 242, 294, 313, 536, 622
HpaII CCGG 1 cut(s) 412
HphI GGTGA 1 cut(s) 335
Hpy188I TCNGA 5 cut(s) 106, 144, 175, 274, 385
Hpy188III TCNNGA 1 cut(s) 149
Hpy99I CGWCG 2 cut(s) 179, 212
HpyAV CCTTC 2 cut(s) 434, 612
HpyCH4III ACNGT 3 cut(s) 164, 304, 323
HpyCH4IV ACGT 1 cut(s) 307
HpyCH4V TGCA 5 cut(s) 71, 259, 473, 482, 512
HpyF10VI GCNNNNNNNGC 3 cut(s) 476, 479, 509
HpySE526I ACGT 1 cut(s) 307
Hsp92II CATG 2 cut(s) 75, 230
HspAI GCGC 1 cut(s) 566
Kzo9I GATC 5 cut(s) 139, 277, 330, 443, 457
LmnI GCTCC 1 cut(s) 19
LpnPI CCDG 7 cut(s) 63, 103, 162, 299, 425, 437, 534
Lsp1109I GCAGC 2 cut(s) 457, 466
LweI GCATC 1 cut(s) 389
MaeI CTAG 2 cut(s) 93, 113
MaeII ACGT 1 cut(s) 307
MaeIII GTNAC 2 cut(s) 281, 419
MalI GATC 5 cut(s) 141, 279, 332, 445, 459
MboI GATC 5 cut(s) 139, 277, 330, 443, 457
MboII GAAGA 4 cut(s) 248, 251, 338, 380
MlsI TGGCCA 2 cut(s) 121, 225
MluCI AATT 3 cut(s) 427, 493, 529
MluNI TGGCCA 2 cut(s) 121, 225
MlyI GAGTC 4 cut(s) 110, 154, 251, 545
MmeI TCCRAC 1 cut(s) 198
MnlI CCTC 7 cut(s) 4, 91, 197, 212, 410, 448, 550
Mox20I TGGCCA 2 cut(s) 121, 225
MscI TGGCCA 2 cut(s) 121, 225
MseI TTAA 1 cut(s) 354
Msp20I TGGCCA 2 cut(s) 121, 225
MspI CCGG 1 cut(s) 412
MspR9I CCNGG 1 cut(s) 413
MwoI GCNNNNNNNGC 3 cut(s) 476, 479, 509
NciI CCSGG 1 cut(s) 413
NdeI CATATG 2 cut(s) 466, 475
NdeII GATC 5 cut(s) 139, 277, 330, 443, 457
NlaIII CATG 2 cut(s) 75, 230
NlaIV GGNNCC 1 cut(s) 15
NspI RCATGY 1 cut(s) 75
PaeI GCATGC 1 cut(s) 75
PfeI GAWTC 3 cut(s) 294, 313, 622
PflMI CCANNNNNTGG 1 cut(s) 583
PkrI GCNGC 3 cut(s) 398, 472, 481
PleI GAGTC 4 cut(s) 109, 153, 250, 544
PpsI GAGTC 4 cut(s) 109, 153, 250, 544
Ppu21I YACGTR 1 cut(s) 308
PspEI GGTNACC 1 cut(s) 419
PspN4I GGNNCC 1 cut(s) 15
RsaI GTAC 2 cut(s) 111, 306
RsaNI GTAC 2 cut(s) 110, 305
SaqAI TTAA 1 cut(s) 354
SatI GCNGC 3 cut(s) 397, 471, 480
Sau3AI GATC 5 cut(s) 139, 277, 330, 443, 457
ScaI AGTACT 1 cut(s) 111
SchI GAGTC 4 cut(s) 110, 154, 251, 545
ScrFI CCNGG 1 cut(s) 413
SetI ASST 3 cut(s) 310, 421, 426
SfaNI GCATC 1 cut(s) 389
SnaBI TACGTA 1 cut(s) 308
SpeI ACTAGT 1 cut(s) 92
SphI GCATGC 1 cut(s) 75
Sse9I AATT 3 cut(s) 427, 493, 529
SsiI CCGC 1 cut(s) 396
SspMI CTAG 2 cut(s) 93, 113
StyD4I CCNGG 1 cut(s) 411
TaaI ACNGT 3 cut(s) 164, 304, 323
TaiI ACGT 1 cut(s) 310
TaqI TCGA 2 cut(s) 192, 460
TasI AATT 3 cut(s) 427, 493, 529
TatI WGTACW 1 cut(s) 109
TauI GCSGC 1 cut(s) 399
TfiI GAWTC 3 cut(s) 294, 313, 622
Tru1I TTAA 1 cut(s) 354
Tru9I TTAA 1 cut(s) 354
TscAI CASTG 1 cut(s) 307
TseI GCWGC 2 cut(s) 470, 479
TspDTI ATGAA 2 cut(s) 17, 390
TspGWI ACGGA 1 cut(s) 225
TspRI CASTG 1 cut(s) 307
Van91I CCANNNNNTGG 1 cut(s) 583
XapI RAATTY 1 cut(s) 427
XceI RCATGY 1 cut(s) 75
XspI CTAG 2 cut(s) 93, 113
ZrmI AGTACT 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.