Rmu_sc0002676.1_g000001

Phosphopantothenate-cysteine ligase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002676.1
Physical Location & Seq
Forward (+)
5082 .. 8311
3230 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002676.1_g000001.1.cds

Sequence Viewer

Length: 978 bp
atggctctaacagatgggttggaaattcctaaacaagtgctggatgcagaaatcaaatccttttatgactcagctcctcctttaaagaacagggatgacgtcagtgaaaaacttgaggcatttgttaagaagaattcgcaaccttctggaaatggaggagctaggagggtggtttgtgtaacctctggtggtaccacggttcctctagagcaacgttgtgttcgctacattgacaacttcagctcaggtcacagaggagcagcttccacagagtactttttgaaggcaggctatgctgttatctttctttatcggaggggaacctgccaaccatattgcagatctcttcccgatgatccgttacttgaatgtctggaaattttggacgagtcaaacattcaagttcaccagtcccattcacaagcagtgaggattgctatcactaagactcatgctgcagtagcagatggcctcttgctgaaacttccctttacaacaatatttgagtatctccagatgttgcagatggttgcgtttacaatacgaagtgttggaccacatgccatgctatatcttgcagcagcagtatctgacttttacgtcccttggaagagcatggcagaacacaaaattcagtcagggtctggtccattggatatgcgacttgttcaggtgccaaagatgctcttagtgctgaggaaagaatgggcccccatggccttctgcatatcattcaagctagaaacagattcaaagatcctgttagagaaagctgatatggctcttatgaagtacaagatgcatatggttgtagccaatgagcttttgagccgaaaggaagaggttgtagttgtcaccagcaatgaaaagatttcagttcaccgaaacaagtctctgggtgttgatgatgtggaaagcccccttattgagcttcttgtggagaggcattcagcctatgttgagaattctgatctatga

Protein Analysis

325

Amino Acids

36.34

Weight (kDa)

6.52

Isoelectric Point (pI)

45.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 599
AatII GACGTC 1 cut(s) 102
Acc36I ACCTGC 1 cut(s) 332
Acc65I GGTACC 1 cut(s) 191
AccB1I GGYRCC 2 cut(s) 191, 673
AclI AACGTT 1 cut(s) 214
AclWI GGATC 2 cut(s) 350, 751
AcsI RAATTY 5 cut(s) 24, 133, 378, 630, 964
AcuI CTGAAG 1 cut(s) 223
AcyI GRCGYC 1 cut(s) 99
AfaI GTAC 3 cut(s) 193, 275, 794
AgsI TTSAA 5 cut(s) 283, 368, 401, 736, 753
AluBI AGCT 8 cut(s) 74, 161, 243, 263, 739, 773, 823, 931
AluI AGCT 8 cut(s) 74, 161, 243, 263, 739, 773, 823, 931
Alw26I GTCTC 1 cut(s) 897
AlwI GGATC 2 cut(s) 350, 751
AlwNI CAGNNNCTG 2 cut(s) 590, 644
AoxI GGCC 3 cut(s) 469, 708, 717
ApaI GGGCCC 1 cut(s) 712
ApeKI GCWGC 4 cut(s) 260, 455, 578, 581
ApoI RAATTY 5 cut(s) 24, 133, 378, 630, 964
Asp718I GGTACC 1 cut(s) 191
AspS9I GGNCC 4 cut(s) 554, 647, 708, 709
AsuHPI GGTGA 3 cut(s) 398, 847, 872
AvaII GGWCC 2 cut(s) 554, 647
BaeGI GKGCMC 1 cut(s) 712
BaeI ACNNNNGTAYC 2 cut(s) 183, 216
BanI GGYRCC 2 cut(s) 191, 673
BanII GRGCYC 1 cut(s) 712
BbvCI CCTCAGC 1 cut(s) 695
BbvI GCAGC 4 cut(s) 272, 442, 590, 593
BccI CCATC 3 cut(s) 8, 461, 520
BcoDI GTCTC 1 cut(s) 897
BfaI CTAG 3 cut(s) 162, 206, 740
BfmI CTRYAG 1 cut(s) 456
BfuAI ACCTGC 1 cut(s) 332
BglI GCCNNNNNGGC 1 cut(s) 716
BglII AGATCT 1 cut(s) 341
BisI GCNGC 4 cut(s) 261, 456, 579, 582
BlsI GCNGC 4 cut(s) 262, 457, 580, 583
BmcAI AGTACT 1 cut(s) 275
Bme18I GGWCC 2 cut(s) 554, 647
BmgT120I GGNCC 4 cut(s) 554, 647, 708, 709
BmiI GGNNCC 6 cut(s) 193, 201, 322, 675, 710, 711
BmsI GCATC 3 cut(s) 34, 672, 789
BpmI CTGGAG 1 cut(s) 497
Bpu10I CCTNAGC 2 cut(s) 244, 695
BpuEI CTTGAG 1 cut(s) 134
BsaBI GATNNNNATC 1 cut(s) 437
BsaHI GRCGYC 1 cut(s) 99
BsaJI CCNNGG 3 cut(s) 195, 605, 714
Bse1I ACTGG 1 cut(s) 409
Bse3DI GCAATG 1 cut(s) 868
Bse8I GATNNNNATC 1 cut(s) 437
BseDI CCNNGG 3 cut(s) 195, 605, 714
BseGI GGATG 2 cut(s) 49, 100
BseJI GATNNNNATC 1 cut(s) 437
BseMI GCAATG 1 cut(s) 868
BseMII CTCAG 3 cut(s) 84, 258, 686
BseNI ACTGG 1 cut(s) 409
BseRI GAGGAG 3 cut(s) 66, 171, 270
BseSI GKGCMC 1 cut(s) 712
BseXI GCAGC 4 cut(s) 272, 442, 590, 593
BshFI GGCC 3 cut(s) 471, 710, 719
BshNI GGYRCC 2 cut(s) 191, 673
BslFI GGGAC 2 cut(s) 397, 587
BsmAI GTCTC 1 cut(s) 897
BsmFI GGGAC 2 cut(s) 397, 587
BsmI GAATGC 1 cut(s) 946
BsnI GGCC 3 cut(s) 471, 710, 719
Bsp120I GGGCCC 1 cut(s) 708
Bsp1286I GDGCHC 1 cut(s) 712
Bsp143I GATC 4 cut(s) 341, 355, 756, 970
Bsp19I CCATGG 1 cut(s) 714
BspANI GGCC 3 cut(s) 471, 710, 719
BspCNI CTCAG 3 cut(s) 83, 257, 687
BspLI GGNNCC 6 cut(s) 193, 201, 322, 675, 710, 711
BspMAI CTGCAG 1 cut(s) 460
BspMI ACCTGC 1 cut(s) 332
BspPI GGATC 2 cut(s) 350, 751
BspQI GCTCTTC 1 cut(s) 605
BspT107I GGYRCC 2 cut(s) 191, 673
BsrDI GCAATG 1 cut(s) 868
BsrI ACTGG 1 cut(s) 409
BssECI CCNNGG 3 cut(s) 195, 605, 714
BssMI GATC 4 cut(s) 341, 355, 756, 970
BssNI GRCGYC 1 cut(s) 99
BssT1I CCWWGG 2 cut(s) 605, 714
Bst4CI ACNGT 1 cut(s) 199
Bst6I CTCTTC 3 cut(s) 351, 605, 834
BstACI GRCGYC 1 cut(s) 99
BstAPI GCANNNNNTGC 1 cut(s) 293
BstC8I GCNNGC 1 cut(s) 289
BstDEI CTNAG 5 cut(s) 70, 244, 444, 688, 695
BstDSI CCRYGG 2 cut(s) 195, 714
BstF5I GGATG 2 cut(s) 49, 100
BstKTI GATC 4 cut(s) 344, 358, 759, 973
BstMAI GTCTC 1 cut(s) 897
BstMBI GATC 4 cut(s) 341, 355, 756, 970
BstMWI GCNNNNNNNGC 6 cut(s) 293, 461, 682, 691, 716, 779
BstNSI RCATGY 1 cut(s) 563
BstSFI CTRYAG 1 cut(s) 456
BstSLI GKGCMC 1 cut(s) 712
BstV1I GCAGC 4 cut(s) 272, 442, 590, 593
BstX2I RGATCY 2 cut(s) 341, 756
BstYI RGATCY 2 cut(s) 341, 756
BsuRI GGCC 3 cut(s) 471, 710, 719
BtgI CCRYGG 2 cut(s) 195, 714
BtsCI GGATG 2 cut(s) 49, 100
BtsI GCAGTG 1 cut(s) 432
BtsIMutI CAGTG 2 cut(s) 109, 432
BveI ACCTGC 1 cut(s) 332
Cac8I GCNNGC 1 cut(s) 289
CaiI CAGNNNCTG 2 cut(s) 590, 644
Cfr13I GGNCC 4 cut(s) 554, 647, 708, 709
Csp6I GTAC 3 cut(s) 192, 274, 793
CviAII CATG 5 cut(s) 452, 560, 565, 616, 715
CviQI GTAC 3 cut(s) 192, 274, 793
DdeI CTNAG 5 cut(s) 70, 244, 444, 688, 695
DpnI GATC 4 cut(s) 343, 357, 758, 972
DpnII GATC 4 cut(s) 341, 355, 756, 970
DraI TTTAAA 1 cut(s) 84
DrdI GACNNNNNNGTC 1 cut(s) 599
DseDI GACNNNNNNGTC 1 cut(s) 599
Eam1104I CTCTTC 3 cut(s) 351, 605, 834
EarI CTCTTC 3 cut(s) 351, 605, 834
Eco130I CCWWGG 2 cut(s) 605, 714
Eco24I GRGCYC 1 cut(s) 712
Eco47I GGWCC 2 cut(s) 554, 647
Eco57I CTGAAG 1 cut(s) 223
EcoO109I RGGNCCY 1 cut(s) 709
EcoRI GAATTC 2 cut(s) 133, 964
EcoT14I CCWWGG 2 cut(s) 605, 714
EcoT22I ATGCAT 1 cut(s) 804
EcoT38I GRGCYC 1 cut(s) 712
ErhI CCWWGG 2 cut(s) 605, 714
FaeI CATG 5 cut(s) 455, 563, 568, 619, 718
FalI AAGNNNNNCTT 2 cut(s) 671, 703
FaqI GGGAC 2 cut(s) 397, 587
FatI CATG 5 cut(s) 451, 559, 564, 615, 714
FauNDI CATATG 1 cut(s) 804
Fnu4HI GCNGC 4 cut(s) 261, 456, 579, 582
FokI GGATG 2 cut(s) 56, 107
FriOI GRGCYC 1 cut(s) 712
Fsp4HI GCNGC 4 cut(s) 261, 456, 579, 582
FspBI CTAG 3 cut(s) 162, 206, 740
GluI GCNGC 4 cut(s) 261, 456, 579, 582
GsuI CTGGAG 1 cut(s) 497
HaeIII GGCC 3 cut(s) 471, 710, 719
Hin1I GRCGYC 1 cut(s) 99
Hin1II CATG 5 cut(s) 455, 563, 568, 619, 718
HinfI GANTC 4 cut(s) 68, 389, 448, 749
HphI GGTGA 3 cut(s) 398, 847, 872
Hpy166II GTNNAC 3 cut(s) 406, 537, 880
Hpy188I TCNGA 3 cut(s) 315, 592, 970
Hpy188III TCNNGA 5 cut(s) 147, 206, 350, 374, 514
Hpy8I GTNNAC 3 cut(s) 406, 537, 880
HpyAV CCTTC 3 cut(s) 153, 277, 730
HpyCH4III ACNGT 1 cut(s) 199
HpyCH4IV ACGT 3 cut(s) 99, 214, 600
HpyCH4V TGCA 7 cut(s) 47, 339, 458, 523, 578, 726, 802
HpyF10VI GCNNNNNNNGC 6 cut(s) 293, 461, 682, 691, 716, 779
HpyF3I CTNAG 5 cut(s) 70, 244, 444, 688, 695
HpySE526I ACGT 3 cut(s) 99, 214, 600
Hsp92I GRCGYC 1 cut(s) 99
Hsp92II CATG 5 cut(s) 455, 563, 568, 619, 718
KpnI GGTACC 1 cut(s) 195
Kzo9I GATC 4 cut(s) 341, 355, 756, 970
LguI GCTCTTC 1 cut(s) 605
LmnI GCTCC 3 cut(s) 79, 158, 257
Lsp1109I GCAGC 4 cut(s) 272, 442, 590, 593
LweI GCATC 3 cut(s) 34, 672, 789
MaeI CTAG 3 cut(s) 162, 206, 740
MaeII ACGT 3 cut(s) 99, 214, 600
MaeIII GTNAC 4 cut(s) 178, 248, 360, 853
MalI GATC 4 cut(s) 343, 357, 758, 972
MboI GATC 4 cut(s) 341, 355, 756, 970
MboII GAAGA 4 cut(s) 142, 338, 622, 851
MflI RGATCY 2 cut(s) 341, 756
MhlI GDGCHC 1 cut(s) 712
MluCI AATT 5 cut(s) 24, 133, 378, 630, 964
MlyI GAGTC 3 cut(s) 62, 398, 442
MmeI TCCRAC 1 cut(s) 532
Mph1103I ATGCAT 1 cut(s) 804
MseI TTAA 2 cut(s) 83, 126
Mva1269I GAATGC 1 cut(s) 946
MwoI GCNNNNNNNGC 6 cut(s) 293, 461, 682, 691, 716, 779
NcoI CCATGG 1 cut(s) 714
NdeI CATATG 1 cut(s) 804
NdeII GATC 4 cut(s) 341, 355, 756, 970
NlaIII CATG 5 cut(s) 455, 563, 568, 619, 718
NlaIV GGNNCC 6 cut(s) 193, 201, 322, 675, 710, 711
NmuCI GTSAC 2 cut(s) 248, 853
NsiI ATGCAT 1 cut(s) 804
NspI RCATGY 1 cut(s) 563
PciSI GCTCTTC 1 cut(s) 605
PctI GAATGC 1 cut(s) 946
PfeI GAWTC 1 cut(s) 749
PkrI GCNGC 4 cut(s) 262, 457, 580, 583
PleI GAGTC 3 cut(s) 62, 397, 442
PpsI GAGTC 3 cut(s) 62, 397, 442
Psp1406I AACGTT 1 cut(s) 214
PspN4I GGNNCC 6 cut(s) 193, 201, 322, 675, 710, 711
PspOMI GGGCCC 1 cut(s) 708
PspPI GGNCC 4 cut(s) 554, 647, 708, 709
PstI CTGCAG 1 cut(s) 460
PstNI CAGNNNCTG 2 cut(s) 590, 644
PsuI RGATCY 2 cut(s) 341, 756
RsaI GTAC 3 cut(s) 193, 275, 794
RsaNI GTAC 3 cut(s) 192, 274, 793
SapI GCTCTTC 1 cut(s) 605
SaqAI TTAA 2 cut(s) 83, 126
SatI GCNGC 4 cut(s) 261, 456, 579, 582
Sau3AI GATC 4 cut(s) 341, 355, 756, 970
Sau96I GGNCC 4 cut(s) 554, 647, 708, 709
ScaI AGTACT 1 cut(s) 275
SchI GAGTC 3 cut(s) 62, 398, 442
SduI GDGCHC 1 cut(s) 712
SfaNI GCATC 3 cut(s) 34, 672, 789
SfcI CTRYAG 1 cut(s) 456
SfiI GGCCNNNNNGGCC 1 cut(s) 716
SinI GGWCC 2 cut(s) 554, 647
SmlI CTYRAG 1 cut(s) 113
SmoI CTYRAG 1 cut(s) 113
Sse9I AATT 5 cut(s) 24, 133, 378, 630, 964
SspI AATATT 1 cut(s) 501
SspMI CTAG 3 cut(s) 162, 206, 740
StyI CCWWGG 2 cut(s) 605, 714
TaaI ACNGT 1 cut(s) 199
TaiI ACGT 3 cut(s) 102, 217, 603
TasI AATT 5 cut(s) 24, 133, 378, 630, 964
TatI WGTACW 2 cut(s) 273, 792
TfiI GAWTC 1 cut(s) 749
Tru1I TTAA 2 cut(s) 83, 126
Tru9I TTAA 2 cut(s) 83, 126
TscAI CASTG 2 cut(s) 109, 432
TseFI GTSAC 2 cut(s) 248, 853
TseI GCWGC 4 cut(s) 260, 455, 578, 581
Tsp45I GTSAC 2 cut(s) 248, 853
TspDTI ATGAA 2 cut(s) 803, 879
TspGWI ACGGA 1 cut(s) 348
TspRI CASTG 2 cut(s) 109, 432
VpaK11BI GGWCC 2 cut(s) 554, 647
XapI RAATTY 5 cut(s) 24, 133, 378, 630, 964
XbaI TCTAGA 1 cut(s) 205
XceI RCATGY 1 cut(s) 563
XspI CTAG 3 cut(s) 162, 206, 740
ZraI GACGTC 1 cut(s) 100
ZrmI AGTACT 1 cut(s) 275
Zsp2I ATGCAT 1 cut(s) 804
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.