Rmu_sc0003139.1_g000038

two-component response regulator

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003139.1
Physical Location & Seq
Forward (+)
158305 .. 160590
2286 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003139.1_g000038.1.cds

Sequence Viewer

Length: 750 bp
atggaggtaatgaagtcattatccgatgttgcagactccaagcaacaacaagaacagcagcagcagcagcagcaacaacatttccatgttttggctgtagatgacagtgttatagacaggaagctgttggagaggctcctcaaaggttcttcatacaaagtgacttgtgtggactctggggatgaagctcttaaatatctgggtttgattgatcatgatgaccaaaaacctacagattcatcttcattcacttccccatatcctcagcagtcgtcatcagaacaagagggctcaaaagtcatcaatctgatcatgacagactactgtatgcccgggatgagcggctatgatttgctgaaaagggtcaagggatcttcttggaaagatataccagtcgtagtcatgtcatcagagaatgttccttcaagaattaacatgtgcttggaagaaggggctgaggagtttctcttaaagccacttcagatatcagatttgaagaagcttcagccttacttgcttaaaacccttgaccaaccttcttctcgtgatagcagcattgacagtagcaacaatctcgtagttgaggagatcggtgatgatgatcacgatggccaaagcaaaatcaatgaggagatcaataagggtagcgtgatgaataatactaatgctagtagtattagcaagaggaaggcagtaactactgaaacatcagacagaatacccaagatgaaaggtttagttgtagcatag

Protein Analysis

249

Amino Acids

27.72

Weight (kDa)

4.88

Isoelectric Point (pI)

61.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 91
AccBSI CCGCTC 1 cut(s) 342
AciI CCGC 1 cut(s) 342
AclWI GGATC 1 cut(s) 379
AcoI YGGCCR 1 cut(s) 610
AcuI CTGAAG 2 cut(s) 464, 488
AfiI CCNNNNNNNGG 1 cut(s) 91
AflIII ACRYGT 1 cut(s) 435
AgsI TTSAA 2 cut(s) 426, 496
AluBI AGCT 3 cut(s) 124, 188, 502
AluI AGCT 3 cut(s) 124, 188, 502
AlwI GGATC 1 cut(s) 379
Ama87I CYCGRG 1 cut(s) 332
AoxI GGCC 1 cut(s) 610
ApeKI GCWGC 6 cut(s) 58, 61, 64, 67, 70, 552
AsuC2I CCSGG 2 cut(s) 333, 334
AsuHPI GGTGA 1 cut(s) 605
AvaI CYCGRG 1 cut(s) 332
BalI TGGCCA 1 cut(s) 612
BanII GRGCYC 1 cut(s) 293
BauI CACGAG 1 cut(s) 543
BbvCI CCTCAGC 2 cut(s) 264, 456
BbvI GCAGC 6 cut(s) 70, 73, 76, 79, 82, 564
BccI CCATC 1 cut(s) 602
BcgI CGANNNNNNTGC 2 cut(s) 556, 590
BclI TGATCA 3 cut(s) 211, 309, 601
BcnI CCSGG 2 cut(s) 333, 334
BfaI CTAG 1 cut(s) 669
BfmI CTRYAG 2 cut(s) 96, 231
BisI GCNGC 7 cut(s) 59, 62, 65, 68, 71, 343, 553
BlsI GCNGC 7 cut(s) 60, 63, 66, 69, 72, 344, 554
Bme1390I CCNGG 2 cut(s) 333, 334
BmeT110I CYCGRG 1 cut(s) 332
BmiI GGNNCC 1 cut(s) 137
BmrFI CCNGG 2 cut(s) 333, 334
Bpu10I CCTNAGC 2 cut(s) 264, 456
BpuMI CCSGG 2 cut(s) 333, 334
BsaBI GATNNNNATC 1 cut(s) 600
BsaJI CCNNGG 1 cut(s) 332
Bsc4I CCNNNNNNNGG 1 cut(s) 91
Bse1I ACTGG 1 cut(s) 392
Bse8I GATNNNNATC 1 cut(s) 600
BseDI CCNNGG 1 cut(s) 332
BseGI GGATG 2 cut(s) 187, 342
BseJI GATNNNNATC 1 cut(s) 600
BseLI CCNNNNNNNGG 1 cut(s) 91
BseMII CTCAG 2 cut(s) 278, 447
BseNI ACTGG 1 cut(s) 392
BseRI GAGGAG 4 cut(s) 128, 473, 599, 644
BseXI GCAGC 6 cut(s) 70, 73, 76, 79, 82, 564
BshFI GGCC 1 cut(s) 612
BsiHKCI CYCGRG 1 cut(s) 332
BsiSI CCGG 1 cut(s) 333
BslI CCNNNNNNNGG 1 cut(s) 91
BsnI GGCC 1 cut(s) 612
BsoBI CYCGRG 1 cut(s) 332
Bsp1286I GDGCHC 1 cut(s) 293
Bsp143I GATC 6 cut(s) 211, 309, 371, 588, 601, 633
BspACI CCGC 1 cut(s) 342
BspANI GGCC 1 cut(s) 612
BspCNI CTCAG 2 cut(s) 277, 448
BspHI TCATGA 2 cut(s) 214, 312
BspLI GGNNCC 1 cut(s) 137
BspPI GGATC 1 cut(s) 379
BsrBI CCGCTC 1 cut(s) 342
BsrI ACTGG 1 cut(s) 392
BssECI CCNNGG 1 cut(s) 332
BssMI GATC 6 cut(s) 211, 309, 371, 588, 601, 633
BssSI CACGAG 1 cut(s) 543
Bst2BI CACGAG 1 cut(s) 543
Bst4CI ACNGT 3 cut(s) 107, 326, 563
BstDEI CTNAG 2 cut(s) 264, 456
BstF5I GGATG 2 cut(s) 187, 342
BstKTI GATC 6 cut(s) 214, 312, 374, 591, 604, 636
BstMBI GATC 6 cut(s) 211, 309, 371, 588, 601, 633
BstMWI GCNNNNNNNGC 4 cut(s) 64, 67, 70, 514
BstNSI RCATGY 1 cut(s) 439
BstSCI CCNGG 2 cut(s) 331, 332
BstSFI CTRYAG 2 cut(s) 96, 231
BstV1I GCAGC 6 cut(s) 70, 73, 76, 79, 82, 564
BstX2I RGATCY 1 cut(s) 371
BstYI RGATCY 1 cut(s) 371
BsuRI GGCC 1 cut(s) 612
BtsCI GGATG 2 cut(s) 187, 342
BtsIMutI CAGTG 1 cut(s) 112
CciI TCATGA 2 cut(s) 214, 312
Cfr9I CCCGGG 1 cut(s) 332
CviAII CATG 5 cut(s) 86, 215, 313, 403, 436
DdeI CTNAG 2 cut(s) 264, 456
DpnI GATC 6 cut(s) 213, 311, 373, 590, 603, 635
DpnII GATC 6 cut(s) 211, 309, 371, 588, 601, 633
EaeI YGGCCR 1 cut(s) 610
Eco24I GRGCYC 1 cut(s) 293
Eco32I GATATC 1 cut(s) 486
Eco57I CTGAAG 2 cut(s) 464, 488
Eco88I CYCGRG 1 cut(s) 332
EcoRV GATATC 1 cut(s) 486
EcoT38I GRGCYC 1 cut(s) 293
FaeI CATG 5 cut(s) 89, 218, 316, 406, 439
FatI CATG 5 cut(s) 85, 214, 312, 402, 435
FbaI TGATCA 3 cut(s) 211, 309, 601
Fnu4HI GCNGC 7 cut(s) 59, 62, 65, 68, 71, 343, 553
FokI GGATG 2 cut(s) 194, 349
FriOI GRGCYC 1 cut(s) 293
Fsp4HI GCNGC 7 cut(s) 59, 62, 65, 68, 71, 343, 553
FspBI CTAG 1 cut(s) 669
GluI GCNGC 7 cut(s) 59, 62, 65, 68, 71, 343, 553
HaeIII GGCC 1 cut(s) 612
HapII CCGG 1 cut(s) 333
Hin1II CATG 5 cut(s) 89, 218, 316, 406, 439
HindIII AAGCTT 1 cut(s) 500
HinfI GANTC 3 cut(s) 35, 173, 236
HpaII CCGG 1 cut(s) 333
HphI GGTGA 1 cut(s) 605
Hpy166II GTNNAC 1 cut(s) 172
Hpy188I TCNGA 7 cut(s) 25, 280, 309, 412, 483, 490, 712
Hpy188III TCNNGA 5 cut(s) 215, 313, 426, 545, 605
Hpy8I GTNNAC 1 cut(s) 172
HpyAV CCTTC 4 cut(s) 432, 443, 546, 682
HpyCH4III ACNGT 3 cut(s) 107, 326, 563
HpyCH4V TGCA 1 cut(s) 32
HpyF10VI GCNNNNNNNGC 4 cut(s) 64, 67, 70, 514
HpyF3I CTNAG 2 cut(s) 264, 456
Hsp92II CATG 5 cut(s) 89, 218, 316, 406, 439
Ksp22I TGATCA 3 cut(s) 211, 309, 601
Kzo9I GATC 6 cut(s) 211, 309, 371, 588, 601, 633
LmnI GCTCC 1 cut(s) 141
LpnPI CCDG 5 cut(s) 103, 162, 185, 346, 405
Lsp1109I GCAGC 6 cut(s) 70, 73, 76, 79, 82, 564
MaeI CTAG 1 cut(s) 669
MaeIII GTNAC 2 cut(s) 160, 694
MalI GATC 6 cut(s) 213, 311, 373, 590, 603, 635
MbiI CCGCTC 1 cut(s) 342
MboI GATC 6 cut(s) 211, 309, 371, 588, 601, 633
MboII GAAGA 6 cut(s) 141, 234, 366, 458, 508, 531
MflI RGATCY 1 cut(s) 371
MhlI GDGCHC 1 cut(s) 293
MlsI TGGCCA 1 cut(s) 612
MluCI AATT 1 cut(s) 429
MluNI TGGCCA 1 cut(s) 612
MlyI GAGTC 2 cut(s) 29, 167
MmeI TCCRAC 1 cut(s) 108
MnlI CCTC 8 cut(s) 126, 149, 273, 280, 451, 577, 622, 678
Mox20I TGGCCA 1 cut(s) 612
MscI TGGCCA 1 cut(s) 612
MseI TTAA 4 cut(s) 192, 432, 470, 519
MslI CAYNNNNRTG 1 cut(s) 84
Msp20I TGGCCA 1 cut(s) 612
MspI CCGG 1 cut(s) 333
MspR9I CCNGG 2 cut(s) 333, 334
MwoI GCNNNNNNNGC 4 cut(s) 64, 67, 70, 514
NciI CCSGG 2 cut(s) 333, 334
NdeII GATC 6 cut(s) 211, 309, 371, 588, 601, 633
NlaIII CATG 5 cut(s) 89, 218, 316, 406, 439
NlaIV GGNNCC 1 cut(s) 137
NmuCI GTSAC 1 cut(s) 160
NspI RCATGY 1 cut(s) 439
PagI TCATGA 2 cut(s) 214, 312
PciI ACATGT 1 cut(s) 435
PfeI GAWTC 1 cut(s) 236
PflMI CCANNNNNTGG 1 cut(s) 91
PkrI GCNGC 7 cut(s) 60, 63, 66, 69, 72, 344, 554
PleI GAGTC 2 cut(s) 29, 167
PpsI GAGTC 2 cut(s) 29, 167
PscI ACATGT 1 cut(s) 435
PspN4I GGNNCC 1 cut(s) 137
PsuI RGATCY 1 cut(s) 371
RseI CAYNNNNRTG 1 cut(s) 84
SaqAI TTAA 4 cut(s) 192, 432, 470, 519
SatI GCNGC 7 cut(s) 59, 62, 65, 68, 71, 343, 553
Sau3AI GATC 6 cut(s) 211, 309, 371, 588, 601, 633
SchI GAGTC 2 cut(s) 29, 167
ScrFI CCNGG 2 cut(s) 333, 334
SduI GDGCHC 1 cut(s) 293
SetI ASST 8 cut(s) 9, 126, 148, 190, 232, 504, 538, 736
SfcI CTRYAG 2 cut(s) 96, 231
SmaI CCCGGG 1 cut(s) 334
SmiMI CAYNNNNRTG 1 cut(s) 84
Sse9I AATT 1 cut(s) 429
SsiI CCGC 1 cut(s) 342
SspMI CTAG 1 cut(s) 669
StyD4I CCNGG 2 cut(s) 331, 332
TaaI ACNGT 3 cut(s) 107, 326, 563
TasI AATT 1 cut(s) 429
TauI GCSGC 1 cut(s) 345
TfiI GAWTC 1 cut(s) 236
Tru1I TTAA 4 cut(s) 192, 432, 470, 519
Tru9I TTAA 4 cut(s) 192, 432, 470, 519
TscAI CASTG 1 cut(s) 112
TseFI GTSAC 1 cut(s) 160
TseI GCWGC 6 cut(s) 58, 61, 64, 67, 70, 552
Tsp45I GTSAC 1 cut(s) 160
TspDTI ATGAA 7 cut(s) 26, 141, 198, 228, 234, 668, 743
TspMI CCCGGG 1 cut(s) 332
TspRI CASTG 1 cut(s) 112
Van91I CCANNNNNTGG 1 cut(s) 91
XceI RCATGY 1 cut(s) 439
XmaI CCCGGG 1 cut(s) 332
XspI CTAG 1 cut(s) 669
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.