Rroxscaffold_1G00051740

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
72458732 .. 72459817
1086 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00051740.1

Sequence Viewer

Length: 225 bp
ATGAGCGGTTATGATTTGCTGAAACGGATCAAGGTGCTTGGAAGAAGGGCACTCGTGGCGTTTCTTTTGAAGCCACCAAAGTTATCAGATTTGAGAAAGCTAATTCAGCCTTACTTGATCAAATCACTCCACCATTCTGGTAACAACAACACCGACGTAGTTGGAAGGTTGTTGATATCAATGACCAGTAAAAAAAAACAACAAAAACCACTTAAGAATAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.45

Weight (kDa)

10.95

Isoelectric Point (pI)

31.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 6
AciI CCGC 1 cut(s) 6
AclWI GGATC 1 cut(s) 35
AflII CTTAAG 1 cut(s) 212
AgsI TTSAA 1 cut(s) 70
AluBI AGCT 1 cut(s) 100
AluI AGCT 1 cut(s) 100
AlwI GGATC 1 cut(s) 35
BaeGI GKGCMC 1 cut(s) 52
BauI CACGAG 1 cut(s) 53
BclI TGATCA 1 cut(s) 117
BfrI CTTAAG 1 cut(s) 212
Bse1I ACTGG 1 cut(s) 186
BseNI ACTGG 1 cut(s) 186
BseSI GKGCMC 1 cut(s) 52
Bsp1286I GDGCHC 1 cut(s) 52
Bsp143I GATC 2 cut(s) 27, 117
BspACI CCGC 1 cut(s) 6
BspPI GGATC 1 cut(s) 35
BspTI CTTAAG 1 cut(s) 212
BsrBI CCGCTC 1 cut(s) 6
BsrI ACTGG 1 cut(s) 186
BssMI GATC 2 cut(s) 27, 117
BssSI CACGAG 1 cut(s) 53
Bst2BI CACGAG 1 cut(s) 53
BstAFI CTTAAG 1 cut(s) 212
BstKTI GATC 2 cut(s) 30, 120
BstMBI GATC 2 cut(s) 27, 117
BstMWI GCNNNNNNNGC 2 cut(s) 56, 106
BstSLI GKGCMC 1 cut(s) 52
BstXI CCANNNNNNTGG 1 cut(s) 137
CviJI RGCY 3 cut(s) 73, 100, 109
CviKI_1 RGCY 3 cut(s) 73, 100, 109
DpnI GATC 2 cut(s) 29, 119
DpnII GATC 2 cut(s) 27, 117
Eco32I GATATC 1 cut(s) 177
EcoRV GATATC 1 cut(s) 177
FaiI YATR 1 cut(s) 12
FbaI TGATCA 1 cut(s) 117
Hpy188I TCNGA 1 cut(s) 88
Hpy99I CGWCG 1 cut(s) 158
HpyAV CCTTC 2 cut(s) 39, 159
HpyCH4IV ACGT 1 cut(s) 156
HpyF10VI GCNNNNNNNGC 2 cut(s) 56, 106
HpySE526I ACGT 1 cut(s) 156
Ksp22I TGATCA 1 cut(s) 117
Kzo9I GATC 2 cut(s) 27, 117
LpnPI CCDG 2 cut(s) 123, 199
MaeII ACGT 1 cut(s) 156
MaeIII GTNAC 1 cut(s) 140
MalI GATC 2 cut(s) 29, 119
MbiI CCGCTC 1 cut(s) 6
MboI GATC 2 cut(s) 27, 117
MboII GAAGA 1 cut(s) 54
MhlI GDGCHC 1 cut(s) 52
MluCI AATT 1 cut(s) 102
MmeI TCCRAC 1 cut(s) 142
MseI TTAA 1 cut(s) 213
MspCI CTTAAG 1 cut(s) 212
MwoI GCNNNNNNNGC 2 cut(s) 56, 106
NdeII GATC 2 cut(s) 27, 117
SaqAI TTAA 1 cut(s) 213
Sau3AI GATC 2 cut(s) 27, 117
SduI GDGCHC 1 cut(s) 52
SetI ASST 4 cut(s) 36, 102, 159, 170
SgeI CNNG 7 cut(s) 43, 50, 65, 67, 127, 150, 198
SmlI CTYRAG 1 cut(s) 212
SmoI CTYRAG 1 cut(s) 212
Sse9I AATT 1 cut(s) 102
SsiI CCGC 1 cut(s) 6
TaiI ACGT 1 cut(s) 159
TasI AATT 1 cut(s) 102
Tru1I TTAA 1 cut(s) 213
Tru9I TTAA 1 cut(s) 213
TspGWI ACGGA 1 cut(s) 40
Vha464I CTTAAG 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.