Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003239.1

Orthogroup ID

OG0005243

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 12790

Gene Structure 12790 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003239.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1494 bp

atgtggaggctgaaggtttcagaaggaggaagagatgggaatccatggctcacaagtgtgaataatcacatcgggagacaattctgggagttcgacccgaatctcggaacaccggaagagcgagctcaagtggaaaaagcacgtcttgattttcataacaatcgagcgagttcggcgtgtaatcatcgaagctttttagacccaaattgggtttggaagattgacggagctgacgacggcgtcgttttaataagaagtggaaggcgggtgtcgcccaacccgaggctcgtccggcttcgatgctccgtcgccaggctcttcgctctcaatttcaggtcggatattgacccacatcctcacgggcgggttgttactcatgaaagccttgaatttgatttgagtgttttgttgttcacagtgattgttttgatcaaaacaggtgggcgacaaccggtgaccggattccggcgaccggtgaccggaatccgatggatggtatacctgcccatgtcatatttatacggcaagagatttgttggtcccatcaacaaccttattttatccctcagaagagagctttatacctttccctatcacctgattgattgggaccaagcaagaaatctatgcgccaaggaggatttgtattacccacatcccattttacaggacgtgctgtgggggtgtcttcataaggttggggaacctcttctcatgagatggccattgtctaacctcaggaaaaaagctctcaccactgtgatggaccacatacactatgaggatgaaaacactcagtatatctgccttggatctgtcaataaggtactaaacatgatttgttgttgggtggaggatcagaattcagaagcatacgagtgtcatctttcaagaatcaaagattgtctatgggttgcagaagatggaatgaaaatgcagggaacgaatggatctcaatgctgggatgttgctttggctgttcaagcaatcctttctaccaaccttgtgaatgaatatggttccgtgcttaagaaggcgcattatttcatcaaaaatgcacaaggcggatggcccttctccactccagacaatggttggcctgtctcagattgtacagctgaaggtttgaaggtacatacgtatgggtcttggggagtttgctacacctatggaacatggtttggaataaaggggttaatggttggtggcaagacctatcagacaagtaatagcattagaagagcatgtcatttcttgctatctaagcaactcgattcaggtggctggggagagagctttctttcatgccaaaacaaggtatacacaaatctcgaagggaacaaaccacatatagtaaacactggatgggctatgttggctctaattgaagcagggcagggtgaaagggacccgatccccttgcatcgagcagcaaaggtattgatcaattcacagatggaaaatggagatttcccacaacaggtatttgctatt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000250 GO:0003674 GO:0003824 GO:0016853 GO:0016866 GO:0031559

KEGG Pathways

Metabolic & Signaling

ko00100 ko01100 ko01110 ko01130 map00100 map01100 map01110 map01130

Pfam Domains

Protein Families

SQHop_cyclase_C SQHop_cyclase_N

Protein Analysis

498

Amino Acids

56.69

Weight (kDa)

8.44

Isoelectric Point (pI)

42.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005243)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G45130 AT3G45130 AT3G45130 AT3G45130 AT3G45130
fragaria_vesca	FvH4_4g06000
malus_domestica	MD16G1237700.v1.1
prunus_persica	Prupe.1G063500_v2.0.a1 Prupe.1G063500_v2.0.a1
rosa_chinensis	RchiOBHm_Chr0c45g0503831 RchiOBHm_Chr1g0332701 RchiOBHm_Chr4g0397241 RchiOBHm_Chr4g0397271 RchiOBHm_Chr4g0397301 RchiOBHm_Chr4g0397321
rosa_laevigata	RLG00000009434 RLG00000009437
rosa_multiflora	Rmu_sc0003239.1_g000001 Rmu_sc0003929.1_g000015 Rmu_sc0008546.1_g000001
rosa_roxburghii	Rroxscaffold_5G00342180 Rroxscaffold_5G00342240 Rroxscaffold_5G00342320
rosa_rugosa	Rorug03G0343000 Rorug03G0343900 Rorug03G0343900
rosa_wichuraiana	Rw4G006330 Rw4G006340 Rw4G006360

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	239
Acc36I	ACCTGC	1 cut(s)	510
AccB7I	CCANNNNNTGG	1 cut(s)	1091
AccI	GTMKAC	2 cut(s)	498, 1320
AciI	CCGC	3 cut(s)	265, 364, 1065
AclWI	GGATC	4 cut(s)	820, 864, 958, 1408
AcoI	YGGCCR	1 cut(s)	722
AcsI	RAATTY	2 cut(s)	389, 862
AcuI	CTGAAG	2 cut(s)	32, 1140
AcyI	GRCGYC	1 cut(s)	240
AfaI	GTAC	3 cut(s)	828, 1114, 1134
AflII	CTTAAG	1 cut(s)	1028
AgeI	ACCGGT	2 cut(s)	451, 472
AgsI	TTSAA	5 cut(s)	389, 891, 983, 1129, 1388
AjiI	CACGTC	2 cut(s)	143, 673
AjnI	CCWGG	1 cut(s)	311
AleI	CACNNNNGTG	2 cut(s)	56, 758
AluBI	AGCT	7 cut(s)	125, 192, 230, 577, 749, 1118, 1296
AluI	AGCT	7 cut(s)	125, 192, 230, 577, 749, 1118, 1296
Alw21I	GWGCWC	1 cut(s)	127
Alw26I	GTCTC	2 cut(s)	70, 1108
AlwI	GGATC	4 cut(s)	820, 864, 958, 1408
Ama87I	CYCGRG	1 cut(s)	280
AoxI	GGCC	3 cut(s)	722, 1070, 1097
ApeKI	GCWGC	1 cut(s)	1430
ApoI	RAATTY	2 cut(s)	389, 862
AsiGI	ACCGGT	2 cut(s)	451, 472
Asp700I	GAANNNNTTC	1 cut(s)	708
AspLEI	GCGC	2 cut(s)	632, 1039
AspS9I	GGNCC	5 cut(s)	539, 610, 766, 1071, 1408
AsuHPI	GGTGA	5 cut(s)	466, 487, 587, 745, 1412
AvaI	CYCGRG	1 cut(s)	280
AvaII	GGWCC	4 cut(s)	539, 610, 766, 1408
AxyI	CCTNAGG	1 cut(s)	737
BaeI	ACNNNNGTAYC	2 cut(s)	1124, 1157
BalI	TGGCCA	1 cut(s)	724
BanII	GRGCYC	1 cut(s)	127
BbsI	GAAGAC	1 cut(s)	680
Bbv12I	GWGCWC	1 cut(s)	127
BbvI	GCAGC	1 cut(s)	1442
BceAI	ACGGC	2 cut(s)	253, 538
BcgI	CGANNNNNNTGC	2 cut(s)	1402, 1436
BciT130I	CCWGG	1 cut(s)	313
BclI	TGATCA	2 cut(s)	429, 1443
BcoDI	GTCTC	2 cut(s)	70, 1108
BfrI	CTTAAG	1 cut(s)	1028
BfuAI	ACCTGC	1 cut(s)	510
BisI	GCNGC	1 cut(s)	1431
BlsI	GCNGC	1 cut(s)	1432
Bme1390I	CCNGG	1 cut(s)	313
Bme18I	GGWCC	4 cut(s)	539, 610, 766, 1408
BmeT110I	CYCGRG	1 cut(s)	280
BmgBI	CACGTC	2 cut(s)	143, 673
BmgT120I	GGNCC	5 cut(s)	539, 610, 766, 1071, 1408
BmiI	GGNNCC	6 cut(s)	541, 611, 705, 1021, 1409, 1410
BmrFI	CCNGG	1 cut(s)	313
BmsI	GCATC	2 cut(s)	290, 1432
BpiI	GAAGAC	1 cut(s)	680
BpmI	CTGGAG	1 cut(s)	1068
BpuEI	CTTGAG	1 cut(s)	111
BsaAI	YACGTR	1 cut(s)	1140
BsaBI	GATNNNNATC	1 cut(s)	39
BsaHI	GRCGYC	1 cut(s)	240
BsaJI	CCNNGG	4 cut(s)	44, 281, 633, 808
BsaWI	WCCGGW	5 cut(s)	112, 451, 458, 472, 479
BsaXI	ACNNNNNCTCC	2 cut(s)	629, 659
Bse118I	RCCGGY	2 cut(s)	451, 472
Bse1I	ACTGG	1 cut(s)	1366
Bse21I	CCTNAGG	1 cut(s)	737
Bse8I	GATNNNNATC	1 cut(s)	39
BseBI	CCWGG	1 cut(s)	313
BseDI	CCNNGG	4 cut(s)	44, 281, 633, 808
BseGI	GGATG	7 cut(s)	352, 498, 655, 790, 970, 1073, 1370
BseJI	GATNNNNATC	1 cut(s)	39
BseMII	CTCAG	4 cut(s)	580, 751, 809, 1119
BseNI	ACTGG	1 cut(s)	1366
BseXI	GCAGC	1 cut(s)	1442
BseYI	CCCAGC	2 cut(s)	960, 1284
Bsh1285I	CGRYCG	1 cut(s)	473
BshFI	GGCC	3 cut(s)	724, 1072, 1099
BshTI	ACCGGT	2 cut(s)	451, 472
BsiEI	CGRYCG	1 cut(s)	473
BsiHKAI	GWGCWC	1 cut(s)	127
BsiHKCI	CYCGRG	1 cut(s)	280
BsiSI	CCGG	7 cut(s)	113, 292, 452, 459, 466, 473, 480
BslFI	GGGAC	3 cut(s)	525, 623, 1421
BsmAI	GTCTC	2 cut(s)	70, 1108
BsmFI	GGGAC	3 cut(s)	525, 623, 1421
BsnI	GGCC	3 cut(s)	724, 1072, 1099
BsoBI	CYCGRG	1 cut(s)	280
Bsp1286I	GDGCHC	1 cut(s)	127
Bsp1407I	TGTACA	1 cut(s)	1112
Bsp143I	GATC	6 cut(s)	429, 812, 856, 950, 1413, 1443
Bsp19I	CCATGG	1 cut(s)	44
BspACI	CCGC	3 cut(s)	265, 364, 1065
BspANI	GGCC	3 cut(s)	724, 1072, 1099
BspCNI	CTCAG	4 cut(s)	579, 750, 808, 1118
BspHI	TCATGA	2 cut(s)	376, 714
BspLI	GGNNCC	6 cut(s)	541, 611, 705, 1021, 1409, 1410
BspMI	ACCTGC	1 cut(s)	510
BspPI	GGATC	4 cut(s)	820, 864, 958, 1408
BspQI	GCTCTTC	3 cut(s)	111, 323, 1234
BspTI	CTTAAG	1 cut(s)	1028
BsrFI	RCCGGY	2 cut(s)	451, 472
BsrGI	TGTACA	1 cut(s)	1112
BsrI	ACTGG	1 cut(s)	1366
BssAI	RCCGGY	2 cut(s)	451, 472
BssECI	CCNNGG	4 cut(s)	44, 281, 633, 808
BssMI	GATC	6 cut(s)	429, 812, 856, 950, 1413, 1443
BssNAI	GTATAC	2 cut(s)	499, 1321
BssNI	GRCGYC	1 cut(s)	240
BssT1I	CCWWGG	3 cut(s)	44, 633, 808
Bst1107I	GTATAC	2 cut(s)	499, 1321
Bst2UI	CCWGG	1 cut(s)	313
Bst4CI	ACNGT	2 cut(s)	418, 760
Bst6I	CTCTTC	6 cut(s)	25, 111, 323, 565, 714, 1234
BstACI	GRCGYC	1 cut(s)	240
BstAFI	CTTAAG	1 cut(s)	1028
BstAUI	TGTACA	1 cut(s)	1112
BstBAI	YACGTR	1 cut(s)	1140
BstC8I	GCNNGC	1 cut(s)	123
BstDEI	CTNAG	5 cut(s)	566, 737, 795, 1105, 1263
BstDSI	CCRYGG	1 cut(s)	44
BstEII	GGTNACC	2 cut(s)	454, 475
BstF5I	GGATG	7 cut(s)	352, 498, 655, 790, 970, 1073, 1370
BstHHI	GCGC	2 cut(s)	632, 1039
BstKTI	GATC	6 cut(s)	432, 815, 859, 953, 1416, 1446
BstMAI	GTCTC	2 cut(s)	70, 1108
BstMBI	GATC	6 cut(s)	429, 812, 856, 950, 1413, 1443
BstMCI	CGRYCG	1 cut(s)	473
BstMWI	GCNNNNNNNGC	6 cut(s)	173, 271, 292, 983, 1264, 1376
BstNI	CCWGG	1 cut(s)	313
BstNSI	RCATGY	1 cut(s)	1248
BstPI	GGTNACC	2 cut(s)	454, 475
BstSCI	CCNGG	1 cut(s)	311
BstSNI	TACGTA	1 cut(s)	1140
BstV1I	GCAGC	1 cut(s)	1442
BstV2I	GAAGAC	1 cut(s)	680
BstX2I	RGATCY	2 cut(s)	812, 950
BstXI	CCANNNNNNTGG	1 cut(s)	763
BstYI	RGATCY	2 cut(s)	812, 950
BstZ17I	GTATAC	2 cut(s)	499, 1321
Bsu36I	CCTNAGG	1 cut(s)	737
BsuRI	GGCC	3 cut(s)	724, 1072, 1099
BtgI	CCRYGG	1 cut(s)	44
BtrI	CACGTC	2 cut(s)	143, 673
BtsCI	GGATG	7 cut(s)	352, 498, 655, 790, 970, 1073, 1370
BtsIMutI	CAGTG	3 cut(s)	423, 756, 1359
BveI	ACCTGC	1 cut(s)	510
Cac8I	GCNNGC	1 cut(s)	123
CciI	TCATGA	2 cut(s)	376, 714
CfoI	GCGC	2 cut(s)	632, 1039
Cfr10I	RCCGGY	2 cut(s)	451, 472
Cfr13I	GGNCC	5 cut(s)	539, 610, 766, 1071, 1408
CseI	GACGC	1 cut(s)	229
Csp6I	GTAC	3 cut(s)	827, 1113, 1133
CspAI	ACCGGT	2 cut(s)	451, 472
CspCI	CAANNNNNGTGG	2 cut(s)	421, 456
CviAII	CATG	8 cut(s)	45, 377, 508, 715, 835, 1176, 1245, 1305
CviQI	GTAC	3 cut(s)	827, 1113, 1133
DdeI	CTNAG	5 cut(s)	566, 737, 795, 1105, 1263
DpnI	GATC	6 cut(s)	431, 814, 858, 952, 1415, 1445
DpnII	GATC	6 cut(s)	429, 812, 856, 950, 1413, 1443
DrdI	GACNNNNNNGTC	1 cut(s)	239
DseDI	GACNNNNNNGTC	1 cut(s)	239
EaeI	YGGCCR	1 cut(s)	722
Eam1104I	CTCTTC	6 cut(s)	25, 111, 323, 565, 714, 1234
EarI	CTCTTC	6 cut(s)	25, 111, 323, 565, 714, 1234
EciI	GGCGGA	1 cut(s)	1080
Ecl136II	GAGCTC	1 cut(s)	125
Eco105I	TACGTA	1 cut(s)	1140
Eco130I	CCWWGG	3 cut(s)	44, 633, 808
Eco24I	GRGCYC	1 cut(s)	127
Eco47I	GGWCC	4 cut(s)	539, 610, 766, 1408
Eco53kI	GAGCTC	1 cut(s)	125
Eco57I	CTGAAG	2 cut(s)	32, 1140
Eco81I	CCTNAGG	1 cut(s)	737
Eco88I	CYCGRG	1 cut(s)	280
Eco91I	GGTNACC	2 cut(s)	454, 475
EcoICRI	GAGCTC	1 cut(s)	125
EcoO109I	RGGNCCY	1 cut(s)	1408
EcoO65I	GGTNACC	2 cut(s)	454, 475
EcoRI	GAATTC	1 cut(s)	862
EcoRII	CCWGG	1 cut(s)	311
EcoT14I	CCWWGG	3 cut(s)	44, 633, 808
EcoT38I	GRGCYC	1 cut(s)	127
ErhI	CCWWGG	3 cut(s)	44, 633, 808
FaeI	CATG	8 cut(s)	48, 380, 511, 718, 838, 1179, 1248, 1308
FalI	AAGNNNNNCTT	4 cut(s)	129, 161, 975, 1007
FaqI	GGGAC	3 cut(s)	525, 623, 1421
FatI	CATG	8 cut(s)	44, 376, 507, 714, 834, 1175, 1244, 1304
FauI	CCCGC	2 cut(s)	258, 357
FbaI	TGATCA	2 cut(s)	429, 1443
FblI	GTMKAC	2 cut(s)	498, 1320
Fnu4HI	GCNGC	1 cut(s)	1431
FokI	GGATG	7 cut(s)	339, 505, 642, 797, 977, 1080, 1377
FriOI	GRGCYC	1 cut(s)	127
Fsp4HI	GCNGC	1 cut(s)	1431
GlaI	GCGC	2 cut(s)	631, 1038
GluI	GCNGC	1 cut(s)	1431
GsaI	CCCAGC	2 cut(s)	964, 1288
GsuI	CTGGAG	1 cut(s)	1068
HaeIII	GGCC	3 cut(s)	724, 1072, 1099
HapII	CCGG	7 cut(s)	113, 292, 452, 459, 466, 473, 480
HgaI	GACGC	1 cut(s)	229
HhaI	GCGC	2 cut(s)	632, 1039
Hin1I	GRCGYC	1 cut(s)	240
Hin1II	CATG	8 cut(s)	48, 380, 511, 718, 838, 1179, 1248, 1308
Hin6I	GCGC	2 cut(s)	630, 1037
HinP1I	GCGC	2 cut(s)	630, 1037
HindIII	AAGCTT	1 cut(s)	190
HinfI	GANTC	6 cut(s)	40, 100, 462, 483, 894, 1274
HpaII	CCGG	7 cut(s)	113, 292, 452, 459, 466, 473, 480
HphI	GGTGA	5 cut(s)	466, 487, 587, 745, 1412
Hpy166II	GTNNAC	4 cut(s)	414, 499, 1321, 1357
Hpy188I	TCNGA	9 cut(s)	22, 107, 340, 488, 569, 861, 868, 1108, 1221
Hpy188III	TCNNGA	8 cut(s)	73, 146, 377, 715, 739, 891, 1085, 1331
Hpy8I	GTNNAC	4 cut(s)	414, 499, 1321, 1357
Hpy99I	CGWCG	3 cut(s)	239, 245, 311
HpyAV	CCTTC	8 cut(s)	7, 17, 255, 1027, 1084, 1115, 1123, 1328
HpyCH4III	ACNGT	2 cut(s)	418, 760
HpyCH4IV	ACGT	3 cut(s)	142, 672, 1139
HpyCH4V	TGCA	4 cut(s)	917, 937, 1058, 1423
HpyF10VI	GCNNNNNNNGC	6 cut(s)	173, 271, 292, 983, 1264, 1376
HpyF3I	CTNAG	5 cut(s)	566, 737, 795, 1105, 1263
HpySE526I	ACGT	3 cut(s)	142, 672, 1139
Hsp92I	GRCGYC	1 cut(s)	240
Hsp92II	CATG	8 cut(s)	48, 380, 511, 718, 838, 1179, 1248, 1308
HspAI	GCGC	2 cut(s)	630, 1037
KflI	GGGWCCC	1 cut(s)	1408
Ksp22I	TGATCA	2 cut(s)	429, 1443
Kzo9I	GATC	6 cut(s)	429, 812, 856, 950, 1413, 1443
LguI	GCTCTTC	3 cut(s)	111, 323, 1234
LmnI	GCTCC	2 cut(s)	227, 308
Lsp1109I	GCAGC	1 cut(s)	1442
LweI	GCATC	2 cut(s)	290, 1432
MaeII	ACGT	3 cut(s)	142, 672, 1139
MaeIII	GTNAC	3 cut(s)	370, 454, 475
MalI	GATC	6 cut(s)	431, 814, 858, 952, 1415, 1445
MboI	GATC	6 cut(s)	429, 812, 856, 950, 1413, 1443
MboII	GAAGA	9 cut(s)	42, 128, 229, 310, 582, 680, 701, 932, 1251
MflI	RGATCY	2 cut(s)	812, 950
MhlI	GDGCHC	1 cut(s)	127
MlsI	TGGCCA	1 cut(s)	724
MluCI	AATT	7 cut(s)	80, 205, 328, 389, 862, 1383, 1447
MluNI	TGGCCA	1 cut(s)	724
MmeI	TCCRAC	1 cut(s)	318
MnlI	CCTC	9 cut(s)	20, 276, 366, 575, 631, 717, 746, 775, 847
Mox20I	TGGCCA	1 cut(s)	724
MroXI	GAANNNNTTC	1 cut(s)	708
MscI	TGGCCA	1 cut(s)	724
MseI	TTAA	3 cut(s)	248, 1029, 1196
MslI	CAYNNNNRTG	5 cut(s)	56, 758, 761, 877, 1140
Msp20I	TGGCCA	1 cut(s)	724
MspA1I	CMGCKG	1 cut(s)	1118
MspCI	CTTAAG	1 cut(s)	1028
MspI	CCGG	7 cut(s)	113, 292, 452, 459, 466, 473, 480
MspR9I	CCNGG	1 cut(s)	313
MvaI	CCWGG	1 cut(s)	313
MwoI	GCNNNNNNNGC	6 cut(s)	173, 271, 292, 983, 1264, 1376
NcoI	CCATGG	1 cut(s)	44
NdeII	GATC	6 cut(s)	429, 812, 856, 950, 1413, 1443
NlaIII	CATG	8 cut(s)	48, 380, 511, 718, 838, 1179, 1248, 1308
NlaIV	GGNNCC	6 cut(s)	541, 611, 705, 1021, 1409, 1410
NmuCI	GTSAC	2 cut(s)	454, 475
NspI	RCATGY	1 cut(s)	1248
OliI	CACNNNNGTG	2 cut(s)	56, 758
PagI	TCATGA	2 cut(s)	376, 714
PciSI	GCTCTTC	3 cut(s)	111, 323, 1234
PcsI	WCGNNNNNNNCGW	3 cut(s)	231, 240, 278
PdmI	GAANNNNTTC	1 cut(s)	708
PfeI	GAWTC	6 cut(s)	40, 100, 462, 483, 894, 1274
PflFI	GACNNNGTC	1 cut(s)	239
PflMI	CCANNNNNTGG	1 cut(s)	1091
PinAI	ACCGGT	2 cut(s)	451, 472
PkrI	GCNGC	1 cut(s)	1432
Ppu21I	YACGTR	1 cut(s)	1140
PpuMI	RGGWCCY	1 cut(s)	1408
Psp124BI	GAGCTC	1 cut(s)	127
Psp5II	RGGWCCY	1 cut(s)	1408
Psp6I	CCWGG	1 cut(s)	311
PspEI	GGTNACC	2 cut(s)	454, 475
PspFI	CCCAGC	2 cut(s)	960, 1284
PspGI	CCWGG	1 cut(s)	311
PspN4I	GGNNCC	6 cut(s)	541, 611, 705, 1021, 1409, 1410
PspPI	GGNCC	5 cut(s)	539, 610, 766, 1071, 1408
PspPPI	RGGWCCY	1 cut(s)	1408
PsuI	RGATCY	2 cut(s)	812, 950
PsyI	GACNNNGTC	1 cut(s)	239
PvuII	CAGCTG	1 cut(s)	1118
RsaI	GTAC	3 cut(s)	828, 1114, 1134
RsaNI	GTAC	3 cut(s)	827, 1113, 1133
RseI	CAYNNNNRTG	5 cut(s)	56, 758, 761, 877, 1140
SacI	GAGCTC	1 cut(s)	127
SapI	GCTCTTC	3 cut(s)	111, 323, 1234
SaqAI	TTAA	3 cut(s)	248, 1029, 1196
SatI	GCNGC	1 cut(s)	1431
Sau3AI	GATC	6 cut(s)	429, 812, 856, 950, 1413, 1443
Sau96I	GGNCC	5 cut(s)	539, 610, 766, 1071, 1408
ScrFI	CCNGG	1 cut(s)	313
SduI	GDGCHC	1 cut(s)	127
SfaNI	GCATC	2 cut(s)	290, 1432
SinI	GGWCC	4 cut(s)	539, 610, 766, 1408
SmiMI	CAYNNNNRTG	5 cut(s)	56, 758, 761, 877, 1140
SmlI	CTYRAG	2 cut(s)	126, 1028
SmoI	CTYRAG	2 cut(s)	126, 1028
SnaBI	TACGTA	1 cut(s)	1140
Sse9I	AATT	7 cut(s)	80, 205, 328, 389, 862, 1383, 1447
SsiI	CCGC	3 cut(s)	265, 364, 1065
SstI	GAGCTC	1 cut(s)	127
StyD4I	CCNGG	1 cut(s)	311
StyI	CCWWGG	3 cut(s)	44, 633, 808
TaaI	ACNGT	2 cut(s)	418, 760
TaiI	ACGT	3 cut(s)	145, 675, 1142
TaqI	TCGA	7 cut(s)	93, 163, 187, 298, 1272, 1332, 1426
TasI	AATT	7 cut(s)	80, 205, 328, 389, 862, 1383, 1447
TatI	WGTACW	1 cut(s)	1112
TfiI	GAWTC	6 cut(s)	40, 100, 462, 483, 894, 1274
Tru1I	TTAA	3 cut(s)	248, 1029, 1196
Tru9I	TTAA	3 cut(s)	248, 1029, 1196
TscAI	CASTG	3 cut(s)	423, 763, 1366
TseFI	GTSAC	2 cut(s)	454, 475
TseI	GCWGC	1 cut(s)	1430
Tsp45I	GTSAC	2 cut(s)	454, 475
TspDTI	ATGAA	8 cut(s)	143, 393, 680, 801, 944, 1026, 1036, 1293
TspGWI	ACGGA	3 cut(s)	240, 295, 1012
TspRI	CASTG	3 cut(s)	423, 763, 1366
Tth111I	GACNNNGTC	1 cut(s)	239
Van91I	CCANNNNNTGG	1 cut(s)	1091
Vha464I	CTTAAG	1 cut(s)	1028
VpaK11BI	GGWCC	4 cut(s)	539, 610, 766, 1408
XapI	RAATTY	2 cut(s)	389, 862
XceI	RCATGY	1 cut(s)	1248
XcmI	CCANNNNNNNNNTGG	2 cut(s)	210, 1092
XmiI	GTMKAC	2 cut(s)	498, 1320
XmnI	GAANNNNTTC	1 cut(s)	708

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.