Rmu_sc0003239.1_g000001

Belongs to the terpene cyclase mutase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003239.1
OG0005243
Physical Location & Seq
Reverse (-)
1 .. 12790
12790 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1494 bp
atgtggaggctgaaggtttcagaaggaggaagagatgggaatccatggctcacaagtgtgaataatcacatcgggagacaattctgggagttcgacccgaatctcggaacaccggaagagcgagctcaagtggaaaaagcacgtcttgattttcataacaatcgagcgagttcggcgtgtaatcatcgaagctttttagacccaaattgggtttggaagattgacggagctgacgacggcgtcgttttaataagaagtggaaggcgggtgtcgcccaacccgaggctcgtccggcttcgatgctccgtcgccaggctcttcgctctcaatttcaggtcggatattgacccacatcctcacgggcgggttgttactcatgaaagccttgaatttgatttgagtgttttgttgttcacagtgattgttttgatcaaaacaggtgggcgacaaccggtgaccggattccggcgaccggtgaccggaatccgatggatggtatacctgcccatgtcatatttatacggcaagagatttgttggtcccatcaacaaccttattttatccctcagaagagagctttatacctttccctatcacctgattgattgggaccaagcaagaaatctatgcgccaaggaggatttgtattacccacatcccattttacaggacgtgctgtgggggtgtcttcataaggttggggaacctcttctcatgagatggccattgtctaacctcaggaaaaaagctctcaccactgtgatggaccacatacactatgaggatgaaaacactcagtatatctgccttggatctgtcaataaggtactaaacatgatttgttgttgggtggaggatcagaattcagaagcatacgagtgtcatctttcaagaatcaaagattgtctatgggttgcagaagatggaatgaaaatgcagggaacgaatggatctcaatgctgggatgttgctttggctgttcaagcaatcctttctaccaaccttgtgaatgaatatggttccgtgcttaagaaggcgcattatttcatcaaaaatgcacaaggcggatggcccttctccactccagacaatggttggcctgtctcagattgtacagctgaaggtttgaaggtacatacgtatgggtcttggggagtttgctacacctatggaacatggtttggaataaaggggttaatggttggtggcaagacctatcagacaagtaatagcattagaagagcatgtcatttcttgctatctaagcaactcgattcaggtggctggggagagagctttctttcatgccaaaacaaggtatacacaaatctcgaagggaacaaaccacatatagtaaacactggatgggctatgttggctctaattgaagcagggcagggtgaaagggacccgatccccttgcatcgagcagcaaaggtattgatcaattcacagatggaaaatggagatttcccacaacaggtatttgctatt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0000250 GO:0003674 GO:0003824 GO:0016853 GO:0016866 GO:0031559
KEGG Pathways
Metabolic & Signaling
ko00100 ko01100 ko01110 ko01130 map00100 map01100 map01110 map01130
Pfam Domains
Protein Families
SQHop_cyclase_C SQHop_cyclase_N

Protein Analysis

498

Amino Acids

56.69

Weight (kDa)

8.44

Isoelectric Point (pI)

42.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SQHop_cyclase_C PF13243 381 - 496 3.2e-18 Squalene-hopene cyclase C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 239
Acc36I ACCTGC 1 cut(s) 510
AccB7I CCANNNNNTGG 1 cut(s) 1091
AccI GTMKAC 2 cut(s) 498, 1320
AciI CCGC 3 cut(s) 265, 364, 1065
AclWI GGATC 4 cut(s) 820, 864, 958, 1408
AcoI YGGCCR 1 cut(s) 722
AcsI RAATTY 2 cut(s) 389, 862
AcuI CTGAAG 2 cut(s) 32, 1140
AcyI GRCGYC 1 cut(s) 240
AfaI GTAC 3 cut(s) 828, 1114, 1134
AflII CTTAAG 1 cut(s) 1028
AgeI ACCGGT 2 cut(s) 451, 472
AgsI TTSAA 5 cut(s) 389, 891, 983, 1129, 1388
AjiI CACGTC 2 cut(s) 143, 673
AjnI CCWGG 1 cut(s) 311
AleI CACNNNNGTG 2 cut(s) 56, 758
AluBI AGCT 7 cut(s) 125, 192, 230, 577, 749, 1118, 1296
AluI AGCT 7 cut(s) 125, 192, 230, 577, 749, 1118, 1296
Alw21I GWGCWC 1 cut(s) 127
Alw26I GTCTC 2 cut(s) 70, 1108
AlwI GGATC 4 cut(s) 820, 864, 958, 1408
Ama87I CYCGRG 1 cut(s) 280
AoxI GGCC 3 cut(s) 722, 1070, 1097
ApeKI GCWGC 1 cut(s) 1430
ApoI RAATTY 2 cut(s) 389, 862
AsiGI ACCGGT 2 cut(s) 451, 472
Asp700I GAANNNNTTC 1 cut(s) 708
AspLEI GCGC 2 cut(s) 632, 1039
AspS9I GGNCC 5 cut(s) 539, 610, 766, 1071, 1408
AsuHPI GGTGA 5 cut(s) 466, 487, 587, 745, 1412
AvaI CYCGRG 1 cut(s) 280
AvaII GGWCC 4 cut(s) 539, 610, 766, 1408
AxyI CCTNAGG 1 cut(s) 737
BaeI ACNNNNGTAYC 2 cut(s) 1124, 1157
BalI TGGCCA 1 cut(s) 724
BanII GRGCYC 1 cut(s) 127
BbsI GAAGAC 1 cut(s) 680
Bbv12I GWGCWC 1 cut(s) 127
BbvI GCAGC 1 cut(s) 1442
BceAI ACGGC 2 cut(s) 253, 538
BcgI CGANNNNNNTGC 2 cut(s) 1402, 1436
BciT130I CCWGG 1 cut(s) 313
BclI TGATCA 2 cut(s) 429, 1443
BcoDI GTCTC 2 cut(s) 70, 1108
BfrI CTTAAG 1 cut(s) 1028
BfuAI ACCTGC 1 cut(s) 510
BisI GCNGC 1 cut(s) 1431
BlsI GCNGC 1 cut(s) 1432
Bme1390I CCNGG 1 cut(s) 313
Bme18I GGWCC 4 cut(s) 539, 610, 766, 1408
BmeT110I CYCGRG 1 cut(s) 280
BmgBI CACGTC 2 cut(s) 143, 673
BmgT120I GGNCC 5 cut(s) 539, 610, 766, 1071, 1408
BmiI GGNNCC 6 cut(s) 541, 611, 705, 1021, 1409, 1410
BmrFI CCNGG 1 cut(s) 313
BmsI GCATC 2 cut(s) 290, 1432
BpiI GAAGAC 1 cut(s) 680
BpmI CTGGAG 1 cut(s) 1068
BpuEI CTTGAG 1 cut(s) 111
BsaAI YACGTR 1 cut(s) 1140
BsaBI GATNNNNATC 1 cut(s) 39
BsaHI GRCGYC 1 cut(s) 240
BsaJI CCNNGG 4 cut(s) 44, 281, 633, 808
BsaWI WCCGGW 5 cut(s) 112, 451, 458, 472, 479
BsaXI ACNNNNNCTCC 2 cut(s) 629, 659
Bse118I RCCGGY 2 cut(s) 451, 472
Bse1I ACTGG 1 cut(s) 1366
Bse21I CCTNAGG 1 cut(s) 737
Bse8I GATNNNNATC 1 cut(s) 39
BseBI CCWGG 1 cut(s) 313
BseDI CCNNGG 4 cut(s) 44, 281, 633, 808
BseGI GGATG 7 cut(s) 352, 498, 655, 790, 970, 1073, 1370
BseJI GATNNNNATC 1 cut(s) 39
BseMII CTCAG 4 cut(s) 580, 751, 809, 1119
BseNI ACTGG 1 cut(s) 1366
BseXI GCAGC 1 cut(s) 1442
BseYI CCCAGC 2 cut(s) 960, 1284
Bsh1285I CGRYCG 1 cut(s) 473
BshFI GGCC 3 cut(s) 724, 1072, 1099
BshTI ACCGGT 2 cut(s) 451, 472
BsiEI CGRYCG 1 cut(s) 473
BsiHKAI GWGCWC 1 cut(s) 127
BsiHKCI CYCGRG 1 cut(s) 280
BsiSI CCGG 7 cut(s) 113, 292, 452, 459, 466, 473, 480
BslFI GGGAC 3 cut(s) 525, 623, 1421
BsmAI GTCTC 2 cut(s) 70, 1108
BsmFI GGGAC 3 cut(s) 525, 623, 1421
BsnI GGCC 3 cut(s) 724, 1072, 1099
BsoBI CYCGRG 1 cut(s) 280
Bsp1286I GDGCHC 1 cut(s) 127
Bsp1407I TGTACA 1 cut(s) 1112
Bsp143I GATC 6 cut(s) 429, 812, 856, 950, 1413, 1443
Bsp19I CCATGG 1 cut(s) 44
BspACI CCGC 3 cut(s) 265, 364, 1065
BspANI GGCC 3 cut(s) 724, 1072, 1099
BspCNI CTCAG 4 cut(s) 579, 750, 808, 1118
BspHI TCATGA 2 cut(s) 376, 714
BspLI GGNNCC 6 cut(s) 541, 611, 705, 1021, 1409, 1410
BspMI ACCTGC 1 cut(s) 510
BspPI GGATC 4 cut(s) 820, 864, 958, 1408
BspQI GCTCTTC 3 cut(s) 111, 323, 1234
BspTI CTTAAG 1 cut(s) 1028
BsrFI RCCGGY 2 cut(s) 451, 472
BsrGI TGTACA 1 cut(s) 1112
BsrI ACTGG 1 cut(s) 1366
BssAI RCCGGY 2 cut(s) 451, 472
BssECI CCNNGG 4 cut(s) 44, 281, 633, 808
BssMI GATC 6 cut(s) 429, 812, 856, 950, 1413, 1443
BssNAI GTATAC 2 cut(s) 499, 1321
BssNI GRCGYC 1 cut(s) 240
BssT1I CCWWGG 3 cut(s) 44, 633, 808
Bst1107I GTATAC 2 cut(s) 499, 1321
Bst2UI CCWGG 1 cut(s) 313
Bst4CI ACNGT 2 cut(s) 418, 760
Bst6I CTCTTC 6 cut(s) 25, 111, 323, 565, 714, 1234
BstACI GRCGYC 1 cut(s) 240
BstAFI CTTAAG 1 cut(s) 1028
BstAUI TGTACA 1 cut(s) 1112
BstBAI YACGTR 1 cut(s) 1140
BstC8I GCNNGC 1 cut(s) 123
BstDEI CTNAG 5 cut(s) 566, 737, 795, 1105, 1263
BstDSI CCRYGG 1 cut(s) 44
BstEII GGTNACC 2 cut(s) 454, 475
BstF5I GGATG 7 cut(s) 352, 498, 655, 790, 970, 1073, 1370
BstHHI GCGC 2 cut(s) 632, 1039
BstKTI GATC 6 cut(s) 432, 815, 859, 953, 1416, 1446
BstMAI GTCTC 2 cut(s) 70, 1108
BstMBI GATC 6 cut(s) 429, 812, 856, 950, 1413, 1443
BstMCI CGRYCG 1 cut(s) 473
BstMWI GCNNNNNNNGC 6 cut(s) 173, 271, 292, 983, 1264, 1376
BstNI CCWGG 1 cut(s) 313
BstNSI RCATGY 1 cut(s) 1248
BstPI GGTNACC 2 cut(s) 454, 475
BstSCI CCNGG 1 cut(s) 311
BstSNI TACGTA 1 cut(s) 1140
BstV1I GCAGC 1 cut(s) 1442
BstV2I GAAGAC 1 cut(s) 680
BstX2I RGATCY 2 cut(s) 812, 950
BstXI CCANNNNNNTGG 1 cut(s) 763
BstYI RGATCY 2 cut(s) 812, 950
BstZ17I GTATAC 2 cut(s) 499, 1321
Bsu36I CCTNAGG 1 cut(s) 737
BsuRI GGCC 3 cut(s) 724, 1072, 1099
BtgI CCRYGG 1 cut(s) 44
BtrI CACGTC 2 cut(s) 143, 673
BtsCI GGATG 7 cut(s) 352, 498, 655, 790, 970, 1073, 1370
BtsIMutI CAGTG 3 cut(s) 423, 756, 1359
BveI ACCTGC 1 cut(s) 510
Cac8I GCNNGC 1 cut(s) 123
CciI TCATGA 2 cut(s) 376, 714
CfoI GCGC 2 cut(s) 632, 1039
Cfr10I RCCGGY 2 cut(s) 451, 472
Cfr13I GGNCC 5 cut(s) 539, 610, 766, 1071, 1408
CseI GACGC 1 cut(s) 229
Csp6I GTAC 3 cut(s) 827, 1113, 1133
CspAI ACCGGT 2 cut(s) 451, 472
CspCI CAANNNNNGTGG 2 cut(s) 421, 456
CviAII CATG 8 cut(s) 45, 377, 508, 715, 835, 1176, 1245, 1305
CviQI GTAC 3 cut(s) 827, 1113, 1133
DdeI CTNAG 5 cut(s) 566, 737, 795, 1105, 1263
DpnI GATC 6 cut(s) 431, 814, 858, 952, 1415, 1445
DpnII GATC 6 cut(s) 429, 812, 856, 950, 1413, 1443
DrdI GACNNNNNNGTC 1 cut(s) 239
DseDI GACNNNNNNGTC 1 cut(s) 239
EaeI YGGCCR 1 cut(s) 722
Eam1104I CTCTTC 6 cut(s) 25, 111, 323, 565, 714, 1234
EarI CTCTTC 6 cut(s) 25, 111, 323, 565, 714, 1234
EciI GGCGGA 1 cut(s) 1080
Ecl136II GAGCTC 1 cut(s) 125
Eco105I TACGTA 1 cut(s) 1140
Eco130I CCWWGG 3 cut(s) 44, 633, 808
Eco24I GRGCYC 1 cut(s) 127
Eco47I GGWCC 4 cut(s) 539, 610, 766, 1408
Eco53kI GAGCTC 1 cut(s) 125
Eco57I CTGAAG 2 cut(s) 32, 1140
Eco81I CCTNAGG 1 cut(s) 737
Eco88I CYCGRG 1 cut(s) 280
Eco91I GGTNACC 2 cut(s) 454, 475
EcoICRI GAGCTC 1 cut(s) 125
EcoO109I RGGNCCY 1 cut(s) 1408
EcoO65I GGTNACC 2 cut(s) 454, 475
EcoRI GAATTC 1 cut(s) 862
EcoRII CCWGG 1 cut(s) 311
EcoT14I CCWWGG 3 cut(s) 44, 633, 808
EcoT38I GRGCYC 1 cut(s) 127
ErhI CCWWGG 3 cut(s) 44, 633, 808
FaeI CATG 8 cut(s) 48, 380, 511, 718, 838, 1179, 1248, 1308
FalI AAGNNNNNCTT 4 cut(s) 129, 161, 975, 1007
FaqI GGGAC 3 cut(s) 525, 623, 1421
FatI CATG 8 cut(s) 44, 376, 507, 714, 834, 1175, 1244, 1304
FauI CCCGC 2 cut(s) 258, 357
FbaI TGATCA 2 cut(s) 429, 1443
FblI GTMKAC 2 cut(s) 498, 1320
Fnu4HI GCNGC 1 cut(s) 1431
FokI GGATG 7 cut(s) 339, 505, 642, 797, 977, 1080, 1377
FriOI GRGCYC 1 cut(s) 127
Fsp4HI GCNGC 1 cut(s) 1431
GlaI GCGC 2 cut(s) 631, 1038
GluI GCNGC 1 cut(s) 1431
GsaI CCCAGC 2 cut(s) 964, 1288
GsuI CTGGAG 1 cut(s) 1068
HaeIII GGCC 3 cut(s) 724, 1072, 1099
HapII CCGG 7 cut(s) 113, 292, 452, 459, 466, 473, 480
HgaI GACGC 1 cut(s) 229
HhaI GCGC 2 cut(s) 632, 1039
Hin1I GRCGYC 1 cut(s) 240
Hin1II CATG 8 cut(s) 48, 380, 511, 718, 838, 1179, 1248, 1308
Hin6I GCGC 2 cut(s) 630, 1037
HinP1I GCGC 2 cut(s) 630, 1037
HindIII AAGCTT 1 cut(s) 190
HinfI GANTC 6 cut(s) 40, 100, 462, 483, 894, 1274
HpaII CCGG 7 cut(s) 113, 292, 452, 459, 466, 473, 480
HphI GGTGA 5 cut(s) 466, 487, 587, 745, 1412
Hpy166II GTNNAC 4 cut(s) 414, 499, 1321, 1357
Hpy188I TCNGA 9 cut(s) 22, 107, 340, 488, 569, 861, 868, 1108, 1221
Hpy188III TCNNGA 8 cut(s) 73, 146, 377, 715, 739, 891, 1085, 1331
Hpy8I GTNNAC 4 cut(s) 414, 499, 1321, 1357
Hpy99I CGWCG 3 cut(s) 239, 245, 311
HpyAV CCTTC 8 cut(s) 7, 17, 255, 1027, 1084, 1115, 1123, 1328
HpyCH4III ACNGT 2 cut(s) 418, 760
HpyCH4IV ACGT 3 cut(s) 142, 672, 1139
HpyCH4V TGCA 4 cut(s) 917, 937, 1058, 1423
HpyF10VI GCNNNNNNNGC 6 cut(s) 173, 271, 292, 983, 1264, 1376
HpyF3I CTNAG 5 cut(s) 566, 737, 795, 1105, 1263
HpySE526I ACGT 3 cut(s) 142, 672, 1139
Hsp92I GRCGYC 1 cut(s) 240
Hsp92II CATG 8 cut(s) 48, 380, 511, 718, 838, 1179, 1248, 1308
HspAI GCGC 2 cut(s) 630, 1037
KflI GGGWCCC 1 cut(s) 1408
Ksp22I TGATCA 2 cut(s) 429, 1443
Kzo9I GATC 6 cut(s) 429, 812, 856, 950, 1413, 1443
LguI GCTCTTC 3 cut(s) 111, 323, 1234
LmnI GCTCC 2 cut(s) 227, 308
Lsp1109I GCAGC 1 cut(s) 1442
LweI GCATC 2 cut(s) 290, 1432
MaeII ACGT 3 cut(s) 142, 672, 1139
MaeIII GTNAC 3 cut(s) 370, 454, 475
MalI GATC 6 cut(s) 431, 814, 858, 952, 1415, 1445
MboI GATC 6 cut(s) 429, 812, 856, 950, 1413, 1443
MboII GAAGA 9 cut(s) 42, 128, 229, 310, 582, 680, 701, 932, 1251
MflI RGATCY 2 cut(s) 812, 950
MhlI GDGCHC 1 cut(s) 127
MlsI TGGCCA 1 cut(s) 724
MluCI AATT 7 cut(s) 80, 205, 328, 389, 862, 1383, 1447
MluNI TGGCCA 1 cut(s) 724
MmeI TCCRAC 1 cut(s) 318
MnlI CCTC 9 cut(s) 20, 276, 366, 575, 631, 717, 746, 775, 847
Mox20I TGGCCA 1 cut(s) 724
MroXI GAANNNNTTC 1 cut(s) 708
MscI TGGCCA 1 cut(s) 724
MseI TTAA 3 cut(s) 248, 1029, 1196
MslI CAYNNNNRTG 5 cut(s) 56, 758, 761, 877, 1140
Msp20I TGGCCA 1 cut(s) 724
MspA1I CMGCKG 1 cut(s) 1118
MspCI CTTAAG 1 cut(s) 1028
MspI CCGG 7 cut(s) 113, 292, 452, 459, 466, 473, 480
MspR9I CCNGG 1 cut(s) 313
MvaI CCWGG 1 cut(s) 313
MwoI GCNNNNNNNGC 6 cut(s) 173, 271, 292, 983, 1264, 1376
NcoI CCATGG 1 cut(s) 44
NdeII GATC 6 cut(s) 429, 812, 856, 950, 1413, 1443
NlaIII CATG 8 cut(s) 48, 380, 511, 718, 838, 1179, 1248, 1308
NlaIV GGNNCC 6 cut(s) 541, 611, 705, 1021, 1409, 1410
NmuCI GTSAC 2 cut(s) 454, 475
NspI RCATGY 1 cut(s) 1248
OliI CACNNNNGTG 2 cut(s) 56, 758
PagI TCATGA 2 cut(s) 376, 714
PciSI GCTCTTC 3 cut(s) 111, 323, 1234
PcsI WCGNNNNNNNCGW 3 cut(s) 231, 240, 278
PdmI GAANNNNTTC 1 cut(s) 708
PfeI GAWTC 6 cut(s) 40, 100, 462, 483, 894, 1274
PflFI GACNNNGTC 1 cut(s) 239
PflMI CCANNNNNTGG 1 cut(s) 1091
PinAI ACCGGT 2 cut(s) 451, 472
PkrI GCNGC 1 cut(s) 1432
Ppu21I YACGTR 1 cut(s) 1140
PpuMI RGGWCCY 1 cut(s) 1408
Psp124BI GAGCTC 1 cut(s) 127
Psp5II RGGWCCY 1 cut(s) 1408
Psp6I CCWGG 1 cut(s) 311
PspEI GGTNACC 2 cut(s) 454, 475
PspFI CCCAGC 2 cut(s) 960, 1284
PspGI CCWGG 1 cut(s) 311
PspN4I GGNNCC 6 cut(s) 541, 611, 705, 1021, 1409, 1410
PspPI GGNCC 5 cut(s) 539, 610, 766, 1071, 1408
PspPPI RGGWCCY 1 cut(s) 1408
PsuI RGATCY 2 cut(s) 812, 950
PsyI GACNNNGTC 1 cut(s) 239
PvuII CAGCTG 1 cut(s) 1118
RsaI GTAC 3 cut(s) 828, 1114, 1134
RsaNI GTAC 3 cut(s) 827, 1113, 1133
RseI CAYNNNNRTG 5 cut(s) 56, 758, 761, 877, 1140
SacI GAGCTC 1 cut(s) 127
SapI GCTCTTC 3 cut(s) 111, 323, 1234
SaqAI TTAA 3 cut(s) 248, 1029, 1196
SatI GCNGC 1 cut(s) 1431
Sau3AI GATC 6 cut(s) 429, 812, 856, 950, 1413, 1443
Sau96I GGNCC 5 cut(s) 539, 610, 766, 1071, 1408
ScrFI CCNGG 1 cut(s) 313
SduI GDGCHC 1 cut(s) 127
SfaNI GCATC 2 cut(s) 290, 1432
SinI GGWCC 4 cut(s) 539, 610, 766, 1408
SmiMI CAYNNNNRTG 5 cut(s) 56, 758, 761, 877, 1140
SmlI CTYRAG 2 cut(s) 126, 1028
SmoI CTYRAG 2 cut(s) 126, 1028
SnaBI TACGTA 1 cut(s) 1140
Sse9I AATT 7 cut(s) 80, 205, 328, 389, 862, 1383, 1447
SsiI CCGC 3 cut(s) 265, 364, 1065
SstI GAGCTC 1 cut(s) 127
StyD4I CCNGG 1 cut(s) 311
StyI CCWWGG 3 cut(s) 44, 633, 808
TaaI ACNGT 2 cut(s) 418, 760
TaiI ACGT 3 cut(s) 145, 675, 1142
TaqI TCGA 7 cut(s) 93, 163, 187, 298, 1272, 1332, 1426
TasI AATT 7 cut(s) 80, 205, 328, 389, 862, 1383, 1447
TatI WGTACW 1 cut(s) 1112
TfiI GAWTC 6 cut(s) 40, 100, 462, 483, 894, 1274
Tru1I TTAA 3 cut(s) 248, 1029, 1196
Tru9I TTAA 3 cut(s) 248, 1029, 1196
TscAI CASTG 3 cut(s) 423, 763, 1366
TseFI GTSAC 2 cut(s) 454, 475
TseI GCWGC 1 cut(s) 1430
Tsp45I GTSAC 2 cut(s) 454, 475
TspDTI ATGAA 8 cut(s) 143, 393, 680, 801, 944, 1026, 1036, 1293
TspGWI ACGGA 3 cut(s) 240, 295, 1012
TspRI CASTG 3 cut(s) 423, 763, 1366
Tth111I GACNNNGTC 1 cut(s) 239
Van91I CCANNNNNTGG 1 cut(s) 1091
Vha464I CTTAAG 1 cut(s) 1028
VpaK11BI GGWCC 4 cut(s) 539, 610, 766, 1408
XapI RAATTY 2 cut(s) 389, 862
XceI RCATGY 1 cut(s) 1248
XcmI CCANNNNNNNNNTGG 2 cut(s) 210, 1092
XmiI GTMKAC 2 cut(s) 498, 1320
XmnI GAANNNNTTC 1 cut(s) 708
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.