Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003410.1

Orthogroup ID

OG0005667

Physical Location & Seq

Genomic Coordinates Forward (+)

32957 .. 34064

Gene Structure 1108 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003410.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 783 bp

atggcaagttccgtcagcagcttcgaagatttcgaattcttgcaattcgaagactctgatcaagactctctctgggaattcattgacctctctgacgccgactctgacaacaacctccccacctcaactccgacgccgaaccaccacaaaactccgagctcatttttgcccaacacttcattcgactccccaatcgcttcgcccatcgccgacttgatccgagcccacacccgccgtcgtcagacccctgtcgttcaccttcttgatctacctttcctgagccctctcaatttcgatgacctccgtggccatgatgatgatgacgtcggcggtgagccacaagttttggctggagcggatgaggaaattggggacgaggacatttgctcaaagattgcaaggaggtttccgaattggaaaaagagggctttttggtgcttaattggggattttgagataatgctgaggaagaggaccaggtcaactcaaaaggatcaagatcaacaccaaatggggcatatgccaatttctaatgctcggtctgaatcacatttccgcccaacttcgcctctagattttagggtgttttcgaatctaggtagcccctttaggtccccaagaccacctcttcatgggcctaagaggagctggggtagtagtaaagtaggcttaagcatcatcgactctcctgatgatgatgatgatgtcaagttttctgggaaagttcccagatcatcagagaagaagaagaagacgaaggaaaaagaaaaacaaaaaagatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

zf-FLZ

Protein Analysis

260

Amino Acids

29.53

Weight (kDa)

5.86

Isoelectric Point (pI)

69.12

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005667)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G34630
fragaria_vesca	FvH4_2g10040 FvH4_4g16763
malus_domestica	MD05G1058600.v1.1 MD10G1066200.v1.1
prunus_persica	Prupe.8G088200_v2.0.a1
pyrus_communis	pycom05g04950 pycom10g05170
rosa_chinensis	RchiOBHm_Chr6g0266971
rosa_laevigata	RLG00000008549 RLG00000014055
rosa_multiflora	Rmu_sc0003410.1_g000007 Rmu_sc0006020.1_g000009 Rmu_sc0011492.1_g000008 Rmu_sc0017071.1_g000001
rosa_roxburghii	Rroxscaffold_1G00048060 Rroxscaffold_7G00201250
rosa_rugosa	Rorug06G0028400
rosa_samantha	Rh2AG625900 Rh3BG182700 Rh4BG428300 Rh4CG443000 Rh4DG231200 Rh4DG245500 Rh4DG424000 Rh6AG149700 Rh6CG145700
rosa_wichuraiana	Rw6G012960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	327
AccBSI	CCGCTC	1 cut(s)	356
AciI	CCGC	4 cut(s)	232, 330, 356, 556
AclWI	GGATC	2 cut(s)	211, 501
AcoI	YGGCCR	1 cut(s)	307
AcsI	RAATTY	2 cut(s)	35, 77
AcyI	GRCGYC	3 cut(s)	96, 134, 324
AfiI	CCNNNNNNNGG	1 cut(s)	632
AflII	CTTAAG	1 cut(s)	670
AjnI	CCWGG	1 cut(s)	476
AjuI	GAANNNNNNNTTGG	2 cut(s)	164, 196
AluBI	AGCT	3 cut(s)	21, 159, 648
AluI	AGCT	3 cut(s)	21, 159, 648
Alw21I	GWGCWC	1 cut(s)	161
AlwI	GGATC	2 cut(s)	211, 501
AoxI	GGCC	2 cut(s)	307, 635
ApeKI	GCWGC	1 cut(s)	18
ApoI	RAATTY	2 cut(s)	35, 77
AspS9I	GGNCC	3 cut(s)	474, 612, 635
AsuHPI	GGTGA	2 cut(s)	248, 344
AsuII	TTCGAA	4 cut(s)	24, 33, 48, 590
AvaII	GGWCC	2 cut(s)	474, 612
BalI	TGGCCA	1 cut(s)	309
BanII	GRGCYC	3 cut(s)	161, 226, 284
BbsI	GAAGAC	2 cut(s)	57, 758
Bbv12I	GWGCWC	1 cut(s)	161
BbvCI	CCTCAGC	1 cut(s)	464
BbvI	GCAGC	1 cut(s)	30
BccI	CCATC	1 cut(s)	212
BceAI	ACGGC	1 cut(s)	219
BciT130I	CCWGG	1 cut(s)	478
BclI	TGATCA	1 cut(s)	58
BfaI	CTAG	2 cut(s)	572, 596
BfrI	CTTAAG	1 cut(s)	670
BisI	GCNGC	1 cut(s)	19
BlsI	GCNGC	1 cut(s)	20
Bme1390I	CCNGG	1 cut(s)	478
Bme18I	GGWCC	2 cut(s)	474, 612
BmgT120I	GGNCC	3 cut(s)	474, 612, 635
BmiI	GGNNCC	1 cut(s)	614
BmrFI	CCNGG	1 cut(s)	478
BmsI	GCATC	1 cut(s)	684
BoxI	GACNNNNGTC	1 cut(s)	248
BpiI	GAAGAC	2 cut(s)	57, 758
BpmI	CTGGAG	1 cut(s)	372
Bpu10I	CCTNAGC	2 cut(s)	278, 464
Bpu14I	TTCGAA	4 cut(s)	24, 33, 48, 590
BsaBI	GATNNNNATC	1 cut(s)	498
BsaHI	GRCGYC	3 cut(s)	96, 134, 324
BsaJI	CCNNGG	1 cut(s)	304
BsaXI	ACNNNNNCTCC	4 cut(s)	112, 142, 637, 667
Bsc4I	CCNNNNNNNGG	1 cut(s)	632
Bse8I	GATNNNNATC	1 cut(s)	498
BseBI	CCWGG	1 cut(s)	478
BseDI	CCNNGG	1 cut(s)	304
BseGI	GGATG	1 cut(s)	364
BseJI	GATNNNNATC	1 cut(s)	498
BseLI	CCNNNNNNNGG	1 cut(s)	632
BseMII	CTCAG	2 cut(s)	269, 455
BseRI	GAGGAG	1 cut(s)	658
BseXI	GCAGC	1 cut(s)	30
BseYI	CCCAGC	1 cut(s)	648
BshFI	GGCC	2 cut(s)	309, 637
BsiHKAI	GWGCWC	1 cut(s)	161
BslFI	GGGAC	2 cut(s)	386, 598
BslI	CCNNNNNNNGG	1 cut(s)	632
BsmFI	GGGAC	2 cut(s)	386, 598
BsnI	GGCC	2 cut(s)	309, 637
Bsp119I	TTCGAA	4 cut(s)	24, 33, 48, 590
Bsp1286I	GDGCHC	3 cut(s)	161, 226, 284
Bsp143I	GATC	6 cut(s)	58, 216, 265, 493, 499, 731
BspACI	CCGC	4 cut(s)	232, 330, 356, 556
BspANI	GGCC	2 cut(s)	309, 637
BspCNI	CTCAG	2 cut(s)	270, 456
BspLI	GGNNCC	1 cut(s)	614
BspPI	GGATC	2 cut(s)	211, 501
BspT104I	TTCGAA	4 cut(s)	24, 33, 48, 590
BspTI	CTTAAG	1 cut(s)	670
BsrBI	CCGCTC	1 cut(s)	356
BssECI	CCNNGG	1 cut(s)	304
BssMI	GATC	6 cut(s)	58, 216, 265, 493, 499, 731
BssNI	GRCGYC	3 cut(s)	96, 134, 324
Bst2UI	CCWGG	1 cut(s)	478
Bst6I	CTCTTC	2 cut(s)	464, 633
BstACI	GRCGYC	3 cut(s)	96, 134, 324
BstAFI	CTTAAG	1 cut(s)	670
BstBI	TTCGAA	4 cut(s)	24, 33, 48, 590
BstDEI	CTNAG	3 cut(s)	278, 464, 639
BstDSI	CCRYGG	1 cut(s)	304
BstF5I	GGATG	1 cut(s)	364
BstKTI	GATC	6 cut(s)	61, 219, 268, 496, 502, 734
BstMBI	GATC	6 cut(s)	58, 216, 265, 493, 499, 731
BstNI	CCWGG	1 cut(s)	478
BstPAI	GACNNNNGTC	1 cut(s)	248
BstSCI	CCNGG	1 cut(s)	476
BstV1I	GCAGC	1 cut(s)	30
BstV2I	GAAGAC	2 cut(s)	57, 758
BsuRI	GGCC	2 cut(s)	309, 637
BtgI	CCRYGG	1 cut(s)	304
BtgZI	GCGATG	1 cut(s)	190
BtsCI	GGATG	1 cut(s)	364
Cfr13I	GGNCC	3 cut(s)	474, 612, 635
CseI	GACGC	2 cut(s)	104, 142
CsiI	ACCWGGT	1 cut(s)	476
CspCI	CAANNNNNGTGG	2 cut(s)	327, 362
CviAII	CATG	2 cut(s)	311, 632
DdeI	CTNAG	3 cut(s)	278, 464, 639
DpnI	GATC	6 cut(s)	60, 218, 267, 495, 501, 733
DpnII	GATC	6 cut(s)	58, 216, 265, 493, 499, 731
EaeI	YGGCCR	1 cut(s)	307
Eam1104I	CTCTTC	2 cut(s)	464, 633
EarI	CTCTTC	2 cut(s)	464, 633
EciI	GGCGGA	1 cut(s)	545
Ecl136II	GAGCTC	1 cut(s)	159
Eco24I	GRGCYC	3 cut(s)	161, 226, 284
Eco47I	GGWCC	2 cut(s)	474, 612
Eco53kI	GAGCTC	1 cut(s)	159
EcoICRI	GAGCTC	1 cut(s)	159
EcoO109I	RGGNCCY	1 cut(s)	612
EcoRI	GAATTC	2 cut(s)	35, 77
EcoRII	CCWGG	1 cut(s)	476
EcoT38I	GRGCYC	3 cut(s)	161, 226, 284
FaeI	CATG	2 cut(s)	314, 635
FaiI	YATR	4 cut(s)	312, 519, 521, 633
FaqI	GGGAC	2 cut(s)	386, 598
FatI	CATG	2 cut(s)	310, 631
FauI	CCCGC	1 cut(s)	239
FauNDI	CATATG	1 cut(s)	519
FbaI	TGATCA	1 cut(s)	58
Fnu4HI	GCNGC	1 cut(s)	19
FokI	GGATG	1 cut(s)	371
FriOI	GRGCYC	3 cut(s)	161, 226, 284
Fsp4HI	GCNGC	1 cut(s)	19
FspBI	CTAG	2 cut(s)	572, 596
GluI	GCNGC	1 cut(s)	19
GsaI	CCCAGC	1 cut(s)	652
GsuI	CTGGAG	1 cut(s)	372
HaeIII	GGCC	2 cut(s)	309, 637
HgaI	GACGC	2 cut(s)	104, 142
Hin1I	GRCGYC	3 cut(s)	96, 134, 324
Hin1II	CATG	2 cut(s)	314, 635
HincII	GTYRAC	1 cut(s)	483
HindII	GTYRAC	1 cut(s)	483
HinfI	GANTC	7 cut(s)	53, 65, 101, 185, 545, 592, 683
HphI	GGTGA	2 cut(s)	248, 344
Hpy166II	GTNNAC	2 cut(s)	256, 483
Hpy188III	TCNNGA	6 cut(s)	62, 263, 277, 497, 572, 689
Hpy8I	GTNNAC	2 cut(s)	256, 483
Hpy99I	CGWCG	3 cut(s)	136, 240, 329
HpyAV	CCTTC	2 cut(s)	269, 751
HpyCH4IV	ACGT	1 cut(s)	324
HpyCH4V	TGCA	2 cut(s)	43, 398
HpyF3I	CTNAG	3 cut(s)	278, 464, 639
HpySE526I	ACGT	1 cut(s)	324
Hsp92I	GRCGYC	3 cut(s)	96, 134, 324
Hsp92II	CATG	2 cut(s)	314, 635
Ksp22I	TGATCA	1 cut(s)	58
Kzo9I	GATC	6 cut(s)	58, 216, 265, 493, 499, 731
LmnI	GCTCC	2 cut(s)	353, 645
Lsp1109I	GCAGC	1 cut(s)	30
LweI	GCATC	1 cut(s)	684
MabI	ACCWGGT	1 cut(s)	476
MaeI	CTAG	2 cut(s)	572, 596
MaeII	ACGT	1 cut(s)	324
MalI	GATC	6 cut(s)	60, 218, 267, 495, 501, 733
MbiI	CCGCTC	1 cut(s)	356
MboI	GATC	6 cut(s)	58, 216, 265, 493, 499, 731
MboII	GAAGA	8 cut(s)	38, 62, 481, 620, 754, 757, 760, 763
MhlI	GDGCHC	3 cut(s)	161, 226, 284
MlsI	TGGCCA	1 cut(s)	309
MluCI	AATT	8 cut(s)	35, 44, 77, 289, 366, 412, 441, 525
MluNI	TGGCCA	1 cut(s)	309
MlyI	GAGTC	5 cut(s)	47, 59, 95, 179, 677
MmeI	TCCRAC	1 cut(s)	155
Mox20I	TGGCCA	1 cut(s)	309
MscI	TGGCCA	1 cut(s)	309
MseI	TTAA	2 cut(s)	440, 671
MslI	CAYNNNNRTG	1 cut(s)	315
Msp20I	TGGCCA	1 cut(s)	309
MspCI	CTTAAG	1 cut(s)	670
MspR9I	CCNGG	1 cut(s)	478
MvaI	CCWGG	1 cut(s)	478
NdeI	CATATG	1 cut(s)	519
NdeII	GATC	6 cut(s)	58, 216, 265, 493, 499, 731
NlaIII	CATG	2 cut(s)	314, 635
NlaIV	GGNNCC	1 cut(s)	614
NspV	TTCGAA	4 cut(s)	24, 33, 48, 590
PcsI	WCGNNNNNNNCGW	1 cut(s)	30
PfeI	GAWTC	2 cut(s)	545, 592
PflFI	GACNNNGTC	1 cut(s)	478
PkrI	GCNGC	1 cut(s)	20
PleI	GAGTC	5 cut(s)	47, 59, 95, 179, 677
PpsI	GAGTC	5 cut(s)	47, 59, 95, 179, 677
PpuMI	RGGWCCY	1 cut(s)	612
PshAI	GACNNNNGTC	1 cut(s)	248
Psp124BI	GAGCTC	1 cut(s)	161
Psp5II	RGGWCCY	1 cut(s)	612
Psp6I	CCWGG	1 cut(s)	476
PspFI	CCCAGC	1 cut(s)	648
PspGI	CCWGG	1 cut(s)	476
PspN4I	GGNNCC	1 cut(s)	614
PspPI	GGNCC	3 cut(s)	474, 612, 635
PspPPI	RGGWCCY	1 cut(s)	612
PsyI	GACNNNGTC	1 cut(s)	478
RseI	CAYNNNNRTG	1 cut(s)	315
SacI	GAGCTC	1 cut(s)	161
SaqAI	TTAA	2 cut(s)	440, 671
SatI	GCNGC	1 cut(s)	19
Sau3AI	GATC	6 cut(s)	58, 216, 265, 493, 499, 731
Sau96I	GGNCC	3 cut(s)	474, 612, 635
SchI	GAGTC	5 cut(s)	47, 59, 95, 179, 677
ScrFI	CCNGG	1 cut(s)	478
SduI	GDGCHC	3 cut(s)	161, 226, 284
SexAI	ACCWGGT	1 cut(s)	476
SfaNI	GCATC	1 cut(s)	684
SfuI	TTCGAA	4 cut(s)	24, 33, 48, 590
SinI	GGWCC	2 cut(s)	474, 612
SmiMI	CAYNNNNRTG	1 cut(s)	315
SmlI	CTYRAG	1 cut(s)	670
SmoI	CTYRAG	1 cut(s)	670
Sse9I	AATT	8 cut(s)	35, 44, 77, 289, 366, 412, 441, 525
SsiI	CCGC	4 cut(s)	232, 330, 356, 556
SspMI	CTAG	2 cut(s)	572, 596
SstI	GAGCTC	1 cut(s)	161
StyD4I	CCNGG	1 cut(s)	476
TaiI	ACGT	1 cut(s)	327
TaqI	TCGA	7 cut(s)	24, 33, 48, 183, 294, 590, 681
TaqII	GACCGA	1 cut(s)	528
TasI	AATT	8 cut(s)	35, 44, 77, 289, 366, 412, 441, 525
TfiI	GAWTC	2 cut(s)	545, 592
Tru1I	TTAA	2 cut(s)	440, 671
Tru9I	TTAA	2 cut(s)	440, 671
TseI	GCWGC	1 cut(s)	18
TspDTI	ATGAA	3 cut(s)	70, 168, 620
TspGWI	ACGGA	1 cut(s)	293
Tth111I	GACNNNGTC	1 cut(s)	478
Vha464I	CTTAAG	1 cut(s)	670
VpaK11BI	GGWCC	2 cut(s)	474, 612
XapI	RAATTY	2 cut(s)	35, 77
XbaI	TCTAGA	1 cut(s)	571
XspI	CTAG	2 cut(s)	572, 596
ZraI	GACGTC	1 cut(s)	325

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.