Rh4CG443000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
67911553 .. 67911768
216 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG443000.1

Sequence Viewer

Length: 216 bp
ATGGCAAGTTTTGTTAATAGCTTCAAAGATTTCGAATTCTTGCAATTCGAAGACTCCGATCAAGACTCTCTCTGGGAATTCATCGACCTCTCCGACGCCAACTCCGACAACAACCTCCCCACCTCAACTCCGACGCCGAACCACCACAAAACTCCGAGCTCATTGGGCCCAACACTTCATTCGACTCCCCAATCGCTTTGCCCATCGCCGACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.87

Weight (kDa)

4.19

Isoelectric Point (pI)

58.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 35, 77
AcyI GRCGYC 2 cut(s) 96, 134
AgsI TTSAA 1 cut(s) 25
AjuI GAANNNNNNNTTGG 2 cut(s) 163, 195
AluBI AGCT 2 cut(s) 21, 159
AluI AGCT 2 cut(s) 21, 159
Alw21I GWGCWC 1 cut(s) 161
AoxI GGCC 1 cut(s) 166
ApaI GGGCCC 1 cut(s) 170
ApoI RAATTY 2 cut(s) 35, 77
AspS9I GGNCC 2 cut(s) 166, 167
AsuII TTCGAA 2 cut(s) 33, 48
BaeGI GKGCMC 1 cut(s) 170
BanII GRGCYC 2 cut(s) 161, 170
BbsI GAAGAC 1 cut(s) 57
Bbv12I GWGCWC 1 cut(s) 161
BccI CCATC 1 cut(s) 211
BmgT120I GGNCC 2 cut(s) 166, 167
BmiI GGNNCC 1 cut(s) 168
BpiI GAAGAC 1 cut(s) 57
Bpu14I TTCGAA 2 cut(s) 33, 48
BsaHI GRCGYC 2 cut(s) 96, 134
BsaXI ACNNNNNCTCC 4 cut(s) 86, 112, 116, 142
BseSI GKGCMC 1 cut(s) 170
BshFI GGCC 1 cut(s) 168
BsiHKAI GWGCWC 1 cut(s) 161
BsnI GGCC 1 cut(s) 168
Bsp119I TTCGAA 2 cut(s) 33, 48
Bsp120I GGGCCC 1 cut(s) 166
Bsp1286I GDGCHC 2 cut(s) 161, 170
Bsp143I GATC 1 cut(s) 58
BspANI GGCC 1 cut(s) 168
BspLI GGNNCC 1 cut(s) 168
BspT104I TTCGAA 2 cut(s) 33, 48
BssMI GATC 1 cut(s) 58
BssNI GRCGYC 2 cut(s) 96, 134
BstACI GRCGYC 2 cut(s) 96, 134
BstBI TTCGAA 2 cut(s) 33, 48
BstKTI GATC 1 cut(s) 61
BstMBI GATC 1 cut(s) 58
BstMWI GCNNNNNNNGC 1 cut(s) 165
BstSLI GKGCMC 1 cut(s) 170
BstV2I GAAGAC 1 cut(s) 57
BsuRI GGCC 1 cut(s) 168
BtgZI GCGATG 1 cut(s) 189
Cfr13I GGNCC 2 cut(s) 166, 167
CseI GACGC 2 cut(s) 104, 142
CviJI RGCY 3 cut(s) 21, 159, 168
CviKI_1 RGCY 3 cut(s) 21, 159, 168
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
Ecl136II GAGCTC 1 cut(s) 159
Eco24I GRGCYC 2 cut(s) 161, 170
Eco53kI GAGCTC 1 cut(s) 159
EcoICRI GAGCTC 1 cut(s) 159
EcoRI GAATTC 2 cut(s) 35, 77
EcoT38I GRGCYC 2 cut(s) 161, 170
FriOI GRGCYC 2 cut(s) 161, 170
HaeIII GGCC 1 cut(s) 168
HgaI GACGC 2 cut(s) 104, 142
Hin1I GRCGYC 2 cut(s) 96, 134
HinfI GANTC 3 cut(s) 53, 65, 184
Hpy188I TCNGA 5 cut(s) 58, 94, 106, 132, 156
Hpy188III TCNNGA 1 cut(s) 62
Hpy99I CGWCG 2 cut(s) 98, 136
HpyCH4V TGCA 1 cut(s) 43
HpyF10VI GCNNNNNNNGC 1 cut(s) 165
Hsp92I GRCGYC 2 cut(s) 96, 134
Kzo9I GATC 1 cut(s) 58
LpnPI CCDG 1 cut(s) 58
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MboII GAAGA 1 cut(s) 62
MhlI GDGCHC 2 cut(s) 161, 170
MluCI AATT 3 cut(s) 35, 44, 77
MlyI GAGTC 3 cut(s) 47, 59, 178
MmeI TCCRAC 3 cut(s) 117, 129, 155
MnlI CCTC 3 cut(s) 98, 125, 133
MseI TTAA 1 cut(s) 15
MwoI GCNNNNNNNGC 1 cut(s) 165
NdeII GATC 1 cut(s) 58
NlaIV GGNNCC 1 cut(s) 168
NspV TTCGAA 2 cut(s) 33, 48
PcsI WCGNNNNNNNCGW 3 cut(s) 54, 90, 102
PleI GAGTC 3 cut(s) 47, 59, 178
PpsI GAGTC 3 cut(s) 47, 59, 178
Psp124BI GAGCTC 1 cut(s) 161
PspN4I GGNNCC 1 cut(s) 168
PspOMI GGGCCC 1 cut(s) 166
PspPI GGNCC 2 cut(s) 166, 167
SacI GAGCTC 1 cut(s) 161
SaqAI TTAA 1 cut(s) 15
Sau3AI GATC 1 cut(s) 58
Sau96I GGNCC 2 cut(s) 166, 167
SchI GAGTC 3 cut(s) 47, 59, 178
SduI GDGCHC 2 cut(s) 161, 170
SetI ASST 6 cut(s) 23, 90, 117, 125, 161, 215
SfuI TTCGAA 2 cut(s) 33, 48
SgeI CNNG 5 cut(s) 18, 52, 74, 85, 168
Sse9I AATT 3 cut(s) 35, 44, 77
SstI GAGCTC 1 cut(s) 161
TaqI TCGA 4 cut(s) 33, 48, 84, 182
TasI AATT 3 cut(s) 35, 44, 77
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TspDTI ATGAA 2 cut(s) 70, 167
XapI RAATTY 2 cut(s) 35, 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.