Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003703.1

Orthogroup ID

OG0005795

Physical Location & Seq

Genomic Coordinates Reverse (-)

16387 .. 19994

Gene Structure 3608 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003703.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1230 bp

atgttgcaccaggttattcagcagcagcaagaacaggatgaaatttcaagccagattagtgctcaaattttcgaattctgtgatcctgaactattccatgagaccctgcagaattctgaggtcacttcttcttcaaattgctgctatgatgaaaactcctcttatgcaacaaatatttcgctgcccctggatttagaaactaaattcagtacctaccaggataacaatggcaacactgacacaaccattgctccaacccccacaacaactagtaccaccaccaccaccaccactagcagcacaaacaccaccactgccagcaccaacaccaccaatatcaacgccactaccgccaccaccaacaacaacaatagtggcaatctttccataatctttgattcccaagaagaaatcgacaatgacatctcagcctccatcgatttttccccatcccctcccttttccgtacctccatttctcatgacccaacaagaccaatttgatttcacttcagtgccaactcaaatcccactagcagattctgttgttgagggattttcacagtatcctgctgaccctgtaccgcctctcatgtcggctcctttgtcatcagttttcgaagaggattgcttgtcctcagtgccttcgtatgtgcctttgaacccctcttctccttcttgttcttttcttggtcctaccatgggagcatacatgcctgctgggactatgaatgctgcagcattatctgctgacagcactggaattttcaccagcagtatcctcatggcttctgaactgcaaccacaagatttggaataccaaggagataatggtggaattttctgtccagaatcattacagaggggttttaatcctgaagaccttcagatgcttggtgctgagagccaacaactggtgagtggggctgggaactctacttctttaccaactgagattcccatggcagaagacccaaattttaaagtagggaagctatctgttgaggaaaggaaagagaagatacatagtatgcctgccgcaaaactcttgcggacagcagacctcgagttagaggaagatttgcgaagaatgatgattttggagagaatcatagaccttctggtagttgtgaaagaggaagaggatatggttgattcctcggacatcttcgctcatatcagtggagtgaactccttcaaatgcagctatcccatccaatcctggatttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0008150 GO:0009314 GO:0009416 GO:0009628 GO:0009909 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0048580 GO:0048831 GO:0050789 GO:0050793 GO:0050896 GO:0051239 GO:0065007 GO:2000026 GO:2000241

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CCT

Protein Analysis

409

Amino Acids

44.44

Weight (kDa)

4.05

Isoelectric Point (pI)

59.81

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005795)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G04500 AT1G04500 AT1G04500 AT1G04500 AT2G33350 AT2G33350 AT2G33350 AT2G33350 AT2G33350
fragaria_vesca	FvH4_4g04500 FvH4_4g04500
malus_domestica	MD13G1220700.v1.1 MD16G1225800.v1.1
prunus_persica	Prupe.1G047400_v2.0.a1 Prupe.1G047400_v2.0.a1
pyrus_communis	pycom13g19510 pycom16g18880
rosa_chinensis	RchiOBHm_Chr4g0395281
rosa_laevigata	RLG00000009637
rosa_multiflora	Rmu_sc0003703.1_g000003
rosa_roxburghii	Rroxscaffold_5G00340150
rosa_rugosa	Rorug03G0358400 Rorug03G0358500
rosa_samantha	Rh4AG057900 Rh4BG056600 Rh4CG062700 Rh4DG053500
rosa_wichuraiana	Rw4G004670

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	913
AciI	CCGC	4 cut(s)	351, 584, 1038, 1051
AclWI	GGATC	1 cut(s)	77
AcsI	RAATTY	8 cut(s)	42, 66, 74, 112, 203, 762, 837, 976
AcuI	CTGAAG	3 cut(s)	495, 869, 897
AfaI	GTAC	4 cut(s)	211, 274, 468, 582
AfiI	CCNNNNNNNGG	2 cut(s)	701, 913
AgsI	TTSAA	4 cut(s)	48, 135, 661, 1198
AhlI	ACTAGT	1 cut(s)	269
AjnI	CCWGG	4 cut(s)	9, 186, 216, 1220
AleI	CACNNNNGTG	1 cut(s)	512
AluBI	AGCT	2 cut(s)	994, 1206
AluI	AGCT	2 cut(s)	994, 1206
Alw21I	GWGCWC	1 cut(s)	64
Alw26I	GTCTC	1 cut(s)	95
AlwI	GGATC	1 cut(s)	77
AlwNI	CAGNNNCTG	1 cut(s)	542
Ama87I	CYCGRG	1 cut(s)	1064
ApeKI	GCWGC	8 cut(s)	22, 25, 141, 181, 297, 734, 737, 1203
ApoI	RAATTY	8 cut(s)	42, 66, 74, 112, 203, 762, 837, 976
Asp700I	GAANNNNTTC	2 cut(s)	882, 1193
AspS9I	GGNCC	1 cut(s)	692
AsuHPI	GGTGA	2 cut(s)	760, 928
AsuII	TTCGAA	2 cut(s)	72, 618
AvaI	CYCGRG	1 cut(s)	1064
AvaII	GGWCC	1 cut(s)	692
BbsI	GAAGAC	2 cut(s)	885, 975
Bbv12I	GWGCWC	1 cut(s)	64
BbvI	GCAGC	8 cut(s)	34, 37, 128, 168, 309, 721, 749, 1215
BccI	CCATC	3 cut(s)	443, 457, 1220
BciT130I	CCWGG	4 cut(s)	11, 188, 218, 1222
BciVI	GTATCC	2 cut(s)	576, 788
BcoDI	GTCTC	1 cut(s)	95
BcuI	ACTAGT	1 cut(s)	269
BfaI	CTAG	3 cut(s)	270, 294, 533
BfmI	CTRYAG	2 cut(s)	107, 735
BfuI	GTATCC	2 cut(s)	576, 788
BisI	GCNGC	9 cut(s)	23, 26, 142, 182, 298, 735, 738, 1038, 1204
BlsI	GCNGC	9 cut(s)	24, 27, 143, 183, 299, 736, 739, 1039, 1205
Bme1390I	CCNGG	4 cut(s)	11, 188, 218, 1222
Bme18I	GGWCC	1 cut(s)	692
BmeT110I	CYCGRG	1 cut(s)	1064
BmgT120I	GGNCC	1 cut(s)	692
BmiI	GGNNCC	1 cut(s)	600
BmrFI	CCNGG	4 cut(s)	11, 188, 218, 1222
BmsI	GCATC	1 cut(s)	879
BpiI	GAAGAC	2 cut(s)	885, 975
Bpu14I	TTCGAA	2 cut(s)	72, 618
Bsa29I	ATCGAT	1 cut(s)	438
BsaI	GGTCTC	1 cut(s)	95
BsaJI	CCNNGG	5 cut(s)	186, 699, 820, 960, 1158
BsaXI	ACNNNNNCTCC	2 cut(s)	235, 265
Bsc4I	CCNNNNNNNGG	2 cut(s)	701, 913
Bse1I	ACTGG	2 cut(s)	763, 918
Bse3DI	GCAATG	1 cut(s)	246
BseBI	CCWGG	4 cut(s)	11, 188, 218, 1222
BseCI	ATCGAT	1 cut(s)	438
BseDI	CCNNGG	5 cut(s)	186, 699, 820, 960, 1158
BseGI	GGATG	3 cut(s)	43, 449, 1212
BseLI	CCNNNNNNNGG	2 cut(s)	701, 913
BseMI	GCAATG	1 cut(s)	246
BseMII	CTCAG	5 cut(s)	108, 441, 651, 891, 942
BseNI	ACTGG	2 cut(s)	763, 918
BseRI	GAGGAG	1 cut(s)	148
BseXI	GCAGC	8 cut(s)	34, 37, 128, 168, 309, 721, 749, 1215
BseYI	CCCAGC	2 cut(s)	719, 926
BshVI	ATCGAT	1 cut(s)	438
BsiHKAI	GWGCWC	1 cut(s)	64
BsiHKCI	CYCGRG	1 cut(s)	1064
BslFI	GGGAC	1 cut(s)	736
BslI	CCNNNNNNNGG	2 cut(s)	701, 913
BsmAI	GTCTC	1 cut(s)	95
BsmFI	GGGAC	1 cut(s)	736
BsmI	GAATGC	1 cut(s)	736
Bso31I	GGTCTC	1 cut(s)	95
BsoBI	CYCGRG	1 cut(s)	1064
Bsp119I	TTCGAA	2 cut(s)	72, 618
Bsp1286I	GDGCHC	1 cut(s)	64
Bsp143I	GATC	1 cut(s)	82
Bsp19I	CCATGG	2 cut(s)	699, 960
BspACI	CCGC	4 cut(s)	351, 584, 1038, 1051
BspCNI	CTCAG	5 cut(s)	109, 440, 650, 892, 943
BspDI	ATCGAT	1 cut(s)	438
BspHI	TCATGA	1 cut(s)	480
BspLI	GGNNCC	1 cut(s)	600
BspMAI	CTGCAG	2 cut(s)	111, 739
BspPI	GGATC	1 cut(s)	77
BspT104I	TTCGAA	2 cut(s)	72, 618
BspTNI	GGTCTC	1 cut(s)	95
BsrDI	GCAATG	1 cut(s)	246
BsrI	ACTGG	2 cut(s)	763, 918
BssECI	CCNNGG	5 cut(s)	186, 699, 820, 960, 1158
BssMI	GATC	1 cut(s)	82
BssT1I	CCWWGG	3 cut(s)	699, 820, 960
Bst2UI	CCWGG	4 cut(s)	11, 188, 218, 1222
Bst4CI	ACNGT	1 cut(s)	564
Bst6I	CTCTTC	3 cut(s)	615, 673, 1134
BstAPI	GCANNNNNTGC	1 cut(s)	746
BstBI	TTCGAA	2 cut(s)	72, 618
BstC8I	GCNNGC	3 cut(s)	319, 717, 1035
BstDEI	CTNAG	5 cut(s)	117, 427, 637, 900, 951
BstDSI	CCRYGG	2 cut(s)	699, 960
BstF5I	GGATG	3 cut(s)	43, 449, 1212
BstKTI	GATC	1 cut(s)	85
BstMAI	GTCTC	1 cut(s)	95
BstMBI	GATC	1 cut(s)	82
BstMWI	GCNNNNNNNGC	2 cut(s)	350, 746
BstNI	CCWGG	4 cut(s)	11, 188, 218, 1222
BstNSI	RCATGY	1 cut(s)	715
BstSCI	CCNGG	4 cut(s)	9, 186, 216, 1220
BstSFI	CTRYAG	2 cut(s)	107, 735
BstV1I	GCAGC	8 cut(s)	34, 37, 128, 168, 309, 721, 749, 1215
BstV2I	GAAGAC	2 cut(s)	885, 975
Bsu15I	ATCGAT	1 cut(s)	438
BsuI	GTATCC	2 cut(s)	576, 788
BsuTUI	ATCGAT	1 cut(s)	438
BtgI	CCRYGG	2 cut(s)	699, 960
BtsCI	GGATG	3 cut(s)	43, 449, 1212
BtsI	GCAGTG	1 cut(s)	312
BtsIMutI	CAGTG	6 cut(s)	234, 312, 519, 645, 756, 1186
Cac8I	GCNNGC	3 cut(s)	319, 717, 1035
CaiI	CAGNNNCTG	1 cut(s)	542
CciI	TCATGA	1 cut(s)	480
Cfr13I	GGNCC	1 cut(s)	692
ClaI	ATCGAT	1 cut(s)	438
CsiI	ACCWGGT	1 cut(s)	9
Csp6I	GTAC	4 cut(s)	210, 273, 467, 581
CspCI	CAANNNNNGTGG	4 cut(s)	355, 390, 792, 827
CviAII	CATG	7 cut(s)	98, 481, 592, 700, 712, 784, 961
CviJI	RGCY	8 cut(s)	51, 431, 599, 788, 906, 926, 994, 1206
CviKI_1	RGCY	8 cut(s)	51, 431, 599, 788, 906, 926, 994, 1206
CviQI	GTAC	4 cut(s)	210, 273, 467, 581
DdeI	CTNAG	5 cut(s)	117, 427, 637, 900, 951
DpnI	GATC	1 cut(s)	84
DpnII	GATC	1 cut(s)	82
DraI	TTTAAA	1 cut(s)	982
Eam1104I	CTCTTC	3 cut(s)	615, 673, 1134
EarI	CTCTTC	3 cut(s)	615, 673, 1134
Eco130I	CCWWGG	3 cut(s)	699, 820, 960
Eco31I	GGTCTC	1 cut(s)	95
Eco47I	GGWCC	1 cut(s)	692
Eco57I	CTGAAG	3 cut(s)	495, 869, 897
Eco88I	CYCGRG	1 cut(s)	1064
EcoRI	GAATTC	2 cut(s)	74, 112
EcoRII	CCWGG	4 cut(s)	9, 186, 216, 1220
EcoT14I	CCWWGG	3 cut(s)	699, 820, 960
ErhI	CCWWGG	3 cut(s)	699, 820, 960
FaeI	CATG	7 cut(s)	101, 484, 595, 703, 715, 787, 964
FaqI	GGGAC	1 cut(s)	736
FatI	CATG	7 cut(s)	97, 480, 591, 699, 711, 783, 960
Fnu4HI	GCNGC	9 cut(s)	23, 26, 142, 182, 298, 735, 738, 1038, 1204
FokI	GGATG	3 cut(s)	50, 436, 1199
Fsp4HI	GCNGC	9 cut(s)	23, 26, 142, 182, 298, 735, 738, 1038, 1204
FspBI	CTAG	3 cut(s)	270, 294, 533
GluI	GCNGC	9 cut(s)	23, 26, 142, 182, 298, 735, 738, 1038, 1204
GsaI	CCCAGC	2 cut(s)	723, 930
Hin1II	CATG	7 cut(s)	101, 484, 595, 703, 715, 787, 964
HinfI	GANTC	6 cut(s)	398, 539, 851, 955, 1107, 1154
HphI	GGTGA	2 cut(s)	760, 928
Hpy166II	GTNNAC	1 cut(s)	1189
Hpy188I	TCNGA	4 cut(s)	118, 793, 888, 1162
Hpy188III	TCNNGA	4 cut(s)	86, 481, 848, 875
Hpy8I	GTNNAC	1 cut(s)	1189
HpyAV	CCTTC	5 cut(s)	654, 684, 893, 1127, 1204
HpyCH4III	ACNGT	1 cut(s)	564
HpyCH4V	TGCA	6 cut(s)	7, 109, 167, 737, 799, 1203
HpyF10VI	GCNNNNNNNGC	2 cut(s)	350, 746
HpyF3I	CTNAG	5 cut(s)	117, 427, 637, 900, 951
Hsp92II	CATG	7 cut(s)	101, 484, 595, 703, 715, 787, 964
Kzo9I	GATC	1 cut(s)	82
LmnI	GCTCC	3 cut(s)	256, 604, 704
Lsp1109I	GCAGC	8 cut(s)	34, 37, 128, 168, 309, 721, 749, 1215
LweI	GCATC	1 cut(s)	879
MabI	ACCWGGT	1 cut(s)	9
MaeI	CTAG	3 cut(s)	270, 294, 533
MaeIII	GTNAC	1 cut(s)	121
MalI	GATC	1 cut(s)	84
MboI	GATC	1 cut(s)	82
MhlI	GDGCHC	1 cut(s)	64
MmeI	TCCRAC	1 cut(s)	278
MroXI	GAANNNNTTC	2 cut(s)	882, 1193
MseI	TTAA	2 cut(s)	870, 981
MslI	CAYNNNNRTG	2 cut(s)	512, 1179
MspR9I	CCNGG	4 cut(s)	11, 188, 218, 1222
Mva1269I	GAATGC	1 cut(s)	736
MvaI	CCWGG	4 cut(s)	11, 188, 218, 1222
MwoI	GCNNNNNNNGC	2 cut(s)	350, 746
NcoI	CCATGG	2 cut(s)	699, 960
NdeII	GATC	1 cut(s)	82
NlaIII	CATG	7 cut(s)	101, 484, 595, 703, 715, 787, 964
NlaIV	GGNNCC	1 cut(s)	600
NmuCI	GTSAC	1 cut(s)	121
NspI	RCATGY	1 cut(s)	715
NspV	TTCGAA	2 cut(s)	72, 618
OliI	CACNNNNGTG	1 cut(s)	512
PaeR7I	CTCGAG	1 cut(s)	1064
PagI	TCATGA	1 cut(s)	480
PctI	GAATGC	1 cut(s)	736
PdmI	GAANNNNTTC	2 cut(s)	882, 1193
PfeI	GAWTC	6 cut(s)	398, 539, 851, 955, 1107, 1154
PflMI	CCANNNNNTGG	1 cut(s)	913
PfoI	TCCNGGA	1 cut(s)	1220
PkrI	GCNGC	9 cut(s)	24, 27, 143, 183, 299, 736, 739, 1039, 1205
Psp6I	CCWGG	4 cut(s)	9, 186, 216, 1220
PspFI	CCCAGC	2 cut(s)	719, 926
PspGI	CCWGG	4 cut(s)	9, 186, 216, 1220
PspN4I	GGNNCC	1 cut(s)	600
PspPI	GGNCC	1 cut(s)	692
PspXI	VCTCGAGB	1 cut(s)	1064
PstI	CTGCAG	2 cut(s)	111, 739
PstNI	CAGNNNCTG	1 cut(s)	542
RsaI	GTAC	4 cut(s)	211, 274, 468, 582
RsaNI	GTAC	4 cut(s)	210, 273, 467, 581
RseI	CAYNNNNRTG	2 cut(s)	512, 1179
SaqAI	TTAA	2 cut(s)	870, 981
SatI	GCNGC	9 cut(s)	23, 26, 142, 182, 298, 735, 738, 1038, 1204
Sau3AI	GATC	1 cut(s)	82
Sau96I	GGNCC	1 cut(s)	692
ScrFI	CCNGG	4 cut(s)	11, 188, 218, 1222
SduI	GDGCHC	1 cut(s)	64
SetI	ASST	9 cut(s)	15, 123, 215, 472, 885, 996, 1065, 1119, 1208
SexAI	ACCWGGT	1 cut(s)	9
SfaNI	GCATC	1 cut(s)	879
SfcI	CTRYAG	2 cut(s)	107, 735
Sfr274I	CTCGAG	1 cut(s)	1064
SfuI	TTCGAA	2 cut(s)	72, 618
SinI	GGWCC	1 cut(s)	692
SlaI	CTCGAG	1 cut(s)	1064
SmiMI	CAYNNNNRTG	2 cut(s)	512, 1179
SmlI	CTYRAG	1 cut(s)	1064
SmoI	CTYRAG	1 cut(s)	1064
SpeI	ACTAGT	1 cut(s)	269
SsiI	CCGC	4 cut(s)	351, 584, 1038, 1051
SspI	AATATT	1 cut(s)	175
SspMI	CTAG	3 cut(s)	270, 294, 533
StyD4I	CCNGG	4 cut(s)	9, 186, 216, 1220
StyI	CCWWGG	3 cut(s)	699, 820, 960
TaaI	ACNGT	1 cut(s)	564
TaqI	TCGA	5 cut(s)	72, 414, 438, 618, 1065
TauI	GCSGC	1 cut(s)	1040
TfiI	GAWTC	6 cut(s)	398, 539, 851, 955, 1107, 1154
Tru1I	TTAA	2 cut(s)	870, 981
Tru9I	TTAA	2 cut(s)	870, 981
TscAI	CASTG	6 cut(s)	241, 319, 519, 645, 763, 1186
TseFI	GTSAC	1 cut(s)	121
TseI	GCWGC	8 cut(s)	22, 25, 141, 181, 297, 734, 737, 1203
Tsp45I	GTSAC	1 cut(s)	121
TspDTI	ATGAA	3 cut(s)	54, 165, 743
TspGWI	ACGGA	1 cut(s)	454
TspRI	CASTG	6 cut(s)	241, 319, 519, 645, 763, 1186
Van91I	CCANNNNNTGG	1 cut(s)	913
VpaK11BI	GGWCC	1 cut(s)	692
XapI	RAATTY	8 cut(s)	42, 66, 74, 112, 203, 762, 837, 976
XceI	RCATGY	1 cut(s)	715
XcmI	CCANNNNNNNNNTGG	2 cut(s)	224, 827
XhoI	CTCGAG	1 cut(s)	1064
XmnI	GAANNNNTTC	2 cut(s)	882, 1193
XspI	CTAG	3 cut(s)	270, 294, 533

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.