Rmu_sc0004465.1_g000026

Glutamate-gated receptor that probably acts as non- selective cation channel

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004465.1
Physical Location & Seq
Forward (+)
112286 .. 113413
1128 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004465.1_g000026.1.cds

Sequence Viewer

Length: 627 bp
atggttgattttacacagccttacatggaatcaggactagttgtagttgttcctatcaaacaggtaaaatcaaggccttgggctttcctgaagccatttactattgagatgtggttagtcaccggtgcattcttcctttttatgggagttgttgtttggattctagagcacaggattaatcacgagttccgtggagagaacactgtgagcactctaggacggctggtgctgattatatggttgtttgtggtgttgattatcaattcgagctatacagctagtttgacatcgatcctcactatacaacagctgacatcacggattgaggggatagacagcttgatatcaagtaatgatccaatcggaattcaagatgcgtcatttgcatggaattatttggttaatgagctcaacatagcagaagttgtcaaaacaatggttgccaagggatatgttcggggacaagatgcattaatcaaggggatttgtcaaaacaatgagtcctatcaagtatcagctactacaacgtccaaggattatgagttagcaattgaatatgggctcatcaaggcaaagaatcttttcaatcacctcaatagctcagggtatgtaggtcatgatacttag

Protein Analysis

208

Amino Acids

23.37

Weight (kDa)

5.79

Isoelectric Point (pI)

25.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 286, 350
AcsI RAATTY 1 cut(s) 366
AcuI CTGAAG 1 cut(s) 110
AfiI CCNNNNNNNGG 1 cut(s) 142
AgeI ACCGGT 1 cut(s) 122
AgsI TTSAA 3 cut(s) 371, 554, 586
AhlI ACTAGT 1 cut(s) 37
AluBI AGCT 7 cut(s) 270, 278, 310, 339, 409, 518, 600
AluI AGCT 7 cut(s) 270, 278, 310, 339, 409, 518, 600
Alw21I GWGCWC 3 cut(s) 171, 212, 411
AlwI GGATC 2 cut(s) 286, 350
AoxI GGCC 1 cut(s) 74
ApoI RAATTY 1 cut(s) 366
AseI ATTAAT 2 cut(s) 177, 473
AsiGI ACCGGT 1 cut(s) 122
Asp700I GAANNNNTTC 1 cut(s) 581
AsuHPI GGTGA 2 cut(s) 112, 581
BanII GRGCYC 2 cut(s) 411, 564
BauI CACGAG 1 cut(s) 182
Bbv12I GWGCWC 3 cut(s) 171, 212, 411
BceAI ACGGC 1 cut(s) 236
BcuI ACTAGT 1 cut(s) 37
BfaI CTAG 4 cut(s) 38, 164, 215, 279
BmsI GCATC 2 cut(s) 364, 457
Bpu10I CCTNAGC 1 cut(s) 601
Bsa29I ATCGAT 1 cut(s) 290
BsaJI CCNNGG 4 cut(s) 77, 190, 444, 531
BsaWI WCCGGW 1 cut(s) 122
BsaXI ACNNNNNCTCC 2 cut(s) 138, 168
Bsc4I CCNNNNNNNGG 1 cut(s) 142
Bse118I RCCGGY 1 cut(s) 122
BseCI ATCGAT 1 cut(s) 290
BseDI CCNNGG 4 cut(s) 77, 190, 444, 531
BseLI CCNNNNNNNGG 1 cut(s) 142
BseMII CTCAG 1 cut(s) 615
BshFI GGCC 1 cut(s) 76
BshTI ACCGGT 1 cut(s) 122
BshVI ATCGAT 1 cut(s) 290
BsiHKAI GWGCWC 3 cut(s) 171, 212, 411
BsiSI CCGG 1 cut(s) 123
BslFI GGGAC 1 cut(s) 474
BslI CCNNNNNNNGG 1 cut(s) 142
BsmFI GGGAC 1 cut(s) 474
BsmI GAATGC 1 cut(s) 128
BsnI GGCC 1 cut(s) 76
Bsp1286I GDGCHC 4 cut(s) 171, 212, 411, 564
Bsp143I GATC 2 cut(s) 291, 355
BspANI GGCC 1 cut(s) 76
BspCNI CTCAG 1 cut(s) 614
BspDI ATCGAT 1 cut(s) 290
BspHI TCATGA 1 cut(s) 616
BspPI GGATC 2 cut(s) 286, 350
BsrFI RCCGGY 1 cut(s) 122
BssAI RCCGGY 1 cut(s) 122
BssECI CCNNGG 4 cut(s) 77, 190, 444, 531
BssMI GATC 2 cut(s) 291, 355
BssSI CACGAG 1 cut(s) 182
BssT1I CCWWGG 3 cut(s) 77, 444, 531
Bst2BI CACGAG 1 cut(s) 182
Bst4CI ACNGT 1 cut(s) 205
BstDEI CTNAG 2 cut(s) 601, 624
BstDSI CCRYGG 1 cut(s) 190
BstKTI GATC 2 cut(s) 294, 358
BstMBI GATC 2 cut(s) 291, 355
BstMWI GCNNNNNNNGC 1 cut(s) 383
Bsu15I ATCGAT 1 cut(s) 290
BsuRI GGCC 1 cut(s) 76
BsuTUI ATCGAT 1 cut(s) 290
BtgI CCRYGG 1 cut(s) 190
BtsIMutI CAGTG 1 cut(s) 201
CciI TCATGA 1 cut(s) 616
Cfr10I RCCGGY 1 cut(s) 122
ClaI ATCGAT 1 cut(s) 290
CseI GACGC 1 cut(s) 366
CspAI ACCGGT 1 cut(s) 122
CviAII CATG 3 cut(s) 25, 387, 617
DdeI CTNAG 2 cut(s) 601, 624
DpnI GATC 2 cut(s) 293, 357
DpnII GATC 2 cut(s) 291, 355
Ecl136II GAGCTC 1 cut(s) 409
Eco130I CCWWGG 3 cut(s) 77, 444, 531
Eco147I AGGCCT 1 cut(s) 76
Eco24I GRGCYC 2 cut(s) 411, 564
Eco32I GATATC 1 cut(s) 345
Eco53kI GAGCTC 1 cut(s) 409
Eco57I CTGAAG 1 cut(s) 110
EcoICRI GAGCTC 1 cut(s) 409
EcoRI GAATTC 1 cut(s) 366
EcoRV GATATC 1 cut(s) 345
EcoT14I CCWWGG 3 cut(s) 77, 444, 531
EcoT22I ATGCAT 1 cut(s) 472
EcoT38I GRGCYC 2 cut(s) 411, 564
ErhI CCWWGG 3 cut(s) 77, 444, 531
FaeI CATG 3 cut(s) 28, 390, 620
FaqI GGGAC 1 cut(s) 474
FatI CATG 3 cut(s) 24, 386, 616
FriOI GRGCYC 2 cut(s) 411, 564
FspBI CTAG 4 cut(s) 38, 164, 215, 279
HaeIII GGCC 1 cut(s) 76
HapII CCGG 1 cut(s) 123
HgaI GACGC 1 cut(s) 366
Hin1II CATG 3 cut(s) 28, 390, 620
HinfI GANTC 4 cut(s) 29, 160, 500, 577
HpaII CCGG 1 cut(s) 123
HphI GGTGA 2 cut(s) 112, 581
Hpy188I TCNGA 1 cut(s) 365
Hpy188III TCNNGA 6 cut(s) 33, 88, 164, 182, 371, 617
HpyCH4III ACNGT 1 cut(s) 205
HpyCH4IV ACGT 1 cut(s) 527
HpyCH4V TGCA 3 cut(s) 128, 386, 470
HpyF10VI GCNNNNNNNGC 1 cut(s) 383
HpyF3I CTNAG 2 cut(s) 601, 624
HpySE526I ACGT 1 cut(s) 527
Hsp92II CATG 3 cut(s) 28, 390, 620
Kzo9I GATC 2 cut(s) 291, 355
LpnPI CCDG 7 cut(s) 18, 47, 101, 136, 157, 209, 588
LweI GCATC 2 cut(s) 364, 457
MaeI CTAG 4 cut(s) 38, 164, 215, 279
MaeII ACGT 1 cut(s) 527
MaeIII GTNAC 1 cut(s) 118
MalI GATC 2 cut(s) 293, 357
MboI GATC 2 cut(s) 291, 355
MboII GAAGA 1 cut(s) 124
MfeI CAATTG 1 cut(s) 549
MhlI GDGCHC 4 cut(s) 171, 212, 411, 564
MluCI AATT 4 cut(s) 262, 366, 391, 549
MlyI GAGTC 1 cut(s) 509
MnlI CCTC 3 cut(s) 305, 319, 602
Mph1103I ATGCAT 1 cut(s) 472
MroXI GAANNNNTTC 1 cut(s) 581
MseI TTAA 3 cut(s) 177, 402, 473
MslI CAYNNNNRTG 1 cut(s) 385
MspA1I CMGCKG 1 cut(s) 310
MspI CCGG 1 cut(s) 123
MunI CAATTG 1 cut(s) 549
Mva1269I GAATGC 1 cut(s) 128
MwoI GCNNNNNNNGC 1 cut(s) 383
NdeII GATC 2 cut(s) 291, 355
NlaIII CATG 3 cut(s) 28, 390, 620
NmuCI GTSAC 1 cut(s) 118
NsiI ATGCAT 1 cut(s) 472
PagI TCATGA 1 cut(s) 616
PceI AGGCCT 1 cut(s) 76
PctI GAATGC 1 cut(s) 128
PdmI GAANNNNTTC 1 cut(s) 581
PfeI GAWTC 3 cut(s) 29, 160, 577
PinAI ACCGGT 1 cut(s) 122
PleI GAGTC 1 cut(s) 508
PpsI GAGTC 1 cut(s) 508
PshBI ATTAAT 2 cut(s) 177, 473
Psp124BI GAGCTC 1 cut(s) 411
PvuII CAGCTG 1 cut(s) 310
RseI CAYNNNNRTG 1 cut(s) 385
SacI GAGCTC 1 cut(s) 411
SaqAI TTAA 3 cut(s) 177, 402, 473
Sau3AI GATC 2 cut(s) 291, 355
SchI GAGTC 1 cut(s) 509
SduI GDGCHC 4 cut(s) 171, 212, 411, 564
SfaNI GCATC 2 cut(s) 364, 457
SgrAI CRCCGGYG 1 cut(s) 122
SmiMI CAYNNNNRTG 1 cut(s) 385
SpeI ACTAGT 1 cut(s) 37
Sse9I AATT 4 cut(s) 262, 366, 391, 549
SseBI AGGCCT 1 cut(s) 76
SspMI CTAG 4 cut(s) 38, 164, 215, 279
SstI GAGCTC 1 cut(s) 411
StuI AGGCCT 1 cut(s) 76
StyI CCWWGG 3 cut(s) 77, 444, 531
TaaI ACNGT 1 cut(s) 205
TaiI ACGT 1 cut(s) 530
TaqI TCGA 2 cut(s) 266, 290
TasI AATT 4 cut(s) 262, 366, 391, 549
TfiI GAWTC 3 cut(s) 29, 160, 577
Tru1I TTAA 3 cut(s) 177, 402, 473
Tru9I TTAA 3 cut(s) 177, 402, 473
TscAI CASTG 1 cut(s) 208
TseFI GTSAC 1 cut(s) 118
Tsp45I GTSAC 1 cut(s) 118
TspGWI ACGGA 2 cut(s) 179, 334
TspRI CASTG 1 cut(s) 208
VspI ATTAAT 2 cut(s) 177, 473
XapI RAATTY 1 cut(s) 366
XbaI TCTAGA 1 cut(s) 163
XmnI GAANNNNTTC 1 cut(s) 581
XspI CTAG 4 cut(s) 38, 164, 215, 279
Zsp2I ATGCAT 1 cut(s) 472
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.