Rh1DG085900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
15955203 .. 15997344
42142 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG085900.1

Sequence Viewer

Length: 186 bp
ATGTCAATGTACACGAAGAAATCATATATTACTAAGAACACATCTGTTGAACTATATGGAGAGGTCTTGCGAAATAGGATGAGGCTAGGATGCAGGCTATTCACACAAGTCAGTTCATTTCTAGCTCTGGCAGTAACTGTTGCTGTGGAAGTTGTCAAAACAATGGTTGCCAAGGGATATGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.88

Weight (kDa)

9.92

Isoelectric Point (pI)

15.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 11
AgsI TTSAA 1 cut(s) 50
AluBI AGCT 1 cut(s) 125
AluI AGCT 1 cut(s) 125
AlwNI CAGNNNCTG 1 cut(s) 137
BfaI CTAG 2 cut(s) 86, 122
BmsI GCATC 1 cut(s) 80
BsaJI CCNNGG 1 cut(s) 171
BseDI CCNNGG 1 cut(s) 171
BseGI GGATG 2 cut(s) 84, 95
Bsp1407I TGTACA 1 cut(s) 9
BsrGI TGTACA 1 cut(s) 9
BssECI CCNNGG 1 cut(s) 171
BssT1I CCWWGG 1 cut(s) 171
Bst4CI ACNGT 1 cut(s) 139
BstAUI TGTACA 1 cut(s) 9
BstC8I GCNNGC 1 cut(s) 95
BstDEI CTNAG 1 cut(s) 33
BstF5I GGATG 2 cut(s) 84, 95
BtsCI GGATG 2 cut(s) 84, 95
Cac8I GCNNGC 1 cut(s) 95
CaiI CAGNNNCTG 1 cut(s) 137
Csp6I GTAC 1 cut(s) 10
CviJI RGCY 3 cut(s) 85, 97, 125
CviKI_1 RGCY 3 cut(s) 85, 97, 125
CviQI GTAC 1 cut(s) 10
DdeI CTNAG 1 cut(s) 33
Eco130I CCWWGG 1 cut(s) 171
EcoT14I CCWWGG 1 cut(s) 171
ErhI CCWWGG 1 cut(s) 171
FaiI YATR 5 cut(s) 25, 27, 55, 57, 180
FokI GGATG 2 cut(s) 91, 102
FspBI CTAG 2 cut(s) 86, 122
Hpy166II GTNNAC 1 cut(s) 12
Hpy8I GTNNAC 1 cut(s) 12
HpyCH4III ACNGT 1 cut(s) 139
HpyCH4V TGCA 1 cut(s) 93
HpyF3I CTNAG 1 cut(s) 33
LpnPI CCDG 2 cut(s) 79, 113
LweI GCATC 1 cut(s) 80
MaeI CTAG 2 cut(s) 86, 122
MaeIII GTNAC 1 cut(s) 133
MboII GAAGA 1 cut(s) 28
MnlI CCTC 2 cut(s) 55, 75
PstNI CAGNNNCTG 1 cut(s) 137
RsaI GTAC 1 cut(s) 11
RsaNI GTAC 1 cut(s) 10
SetI ASST 2 cut(s) 66, 127
SfaNI GCATC 1 cut(s) 80
SgeI CNNG 7 cut(s) 25, 79, 98, 106, 119, 134, 140
SspMI CTAG 2 cut(s) 86, 122
StyI CCWWGG 1 cut(s) 171
TaaI ACNGT 1 cut(s) 139
TatI WGTACW 1 cut(s) 9
TspDTI ATGAA 1 cut(s) 105
XspI CTAG 2 cut(s) 86, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.