Rh6CG523800

RNA recognition motif

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Reverse (-)
67894402 .. 67894794
393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG523800.1

Sequence Viewer

Length: 207 bp
ATGATTGTTGTGGAGATTATGAATGAATCTCCAGCCCATTTGCTTGGTTCTACAAAGCTATTCACACAAGTCAGTTCATTTCTAGCTCTGGCAGTAACTGTTGTTGCAGAAGTTGTCAAAACAATGGTTGCCAAGGGATATGTTCTGGGACAAGATGCATTAATCAAGGGGATTTGTCAAAACAATGAGTTAGGTCATGATACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.24

Weight (kDa)

5.43

Isoelectric Point (pI)

13.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 58, 86
AluI AGCT 2 cut(s) 58, 86
AlwNI CAGNNNCTG 1 cut(s) 98
AseI ATTAAT 1 cut(s) 161
BfaI CTAG 1 cut(s) 83
BmsI GCATC 1 cut(s) 145
BpmI CTGGAG 1 cut(s) 15
BsaJI CCNNGG 1 cut(s) 132
BseDI CCNNGG 1 cut(s) 132
BslFI GGGAC 1 cut(s) 162
BsmFI GGGAC 1 cut(s) 162
BspHI TCATGA 1 cut(s) 196
BssECI CCNNGG 1 cut(s) 132
BssT1I CCWWGG 1 cut(s) 132
Bst4CI ACNGT 1 cut(s) 100
BstDEI CTNAG 1 cut(s) 204
BstXI CCANNNNNNTGG 1 cut(s) 44
CaiI CAGNNNCTG 1 cut(s) 98
CciI TCATGA 1 cut(s) 196
CviAII CATG 1 cut(s) 197
CviJI RGCY 3 cut(s) 35, 58, 86
CviKI_1 RGCY 3 cut(s) 35, 58, 86
DdeI CTNAG 1 cut(s) 204
Eco130I CCWWGG 1 cut(s) 132
EcoT14I CCWWGG 1 cut(s) 132
EcoT22I ATGCAT 1 cut(s) 160
ErhI CCWWGG 1 cut(s) 132
FaeI CATG 1 cut(s) 200
FaiI YATR 3 cut(s) 20, 141, 198
FaqI GGGAC 1 cut(s) 162
FatI CATG 1 cut(s) 196
FspBI CTAG 1 cut(s) 83
GsuI CTGGAG 1 cut(s) 15
Hin1II CATG 1 cut(s) 200
HinfI GANTC 1 cut(s) 26
Hpy188III TCNNGA 1 cut(s) 197
HpyCH4III ACNGT 1 cut(s) 100
HpyCH4V TGCA 2 cut(s) 107, 158
HpyF3I CTNAG 1 cut(s) 204
Hsp92II CATG 1 cut(s) 200
LpnPI CCDG 3 cut(s) 45, 74, 131
LweI GCATC 1 cut(s) 145
MaeI CTAG 1 cut(s) 83
MaeIII GTNAC 1 cut(s) 94
Mph1103I ATGCAT 1 cut(s) 160
MseI TTAA 1 cut(s) 161
NlaIII CATG 1 cut(s) 200
NsiI ATGCAT 1 cut(s) 160
PagI TCATGA 1 cut(s) 196
PfeI GAWTC 1 cut(s) 26
PshBI ATTAAT 1 cut(s) 161
PstNI CAGNNNCTG 1 cut(s) 98
SaqAI TTAA 1 cut(s) 161
SetI ASST 3 cut(s) 60, 88, 196
SfaNI GCATC 1 cut(s) 145
SgeI CNNG 9 cut(s) 44, 56, 80, 95, 101, 145, 158, 164, 178
SspMI CTAG 1 cut(s) 83
StyI CCWWGG 1 cut(s) 132
TaaI ACNGT 1 cut(s) 100
TfiI GAWTC 1 cut(s) 26
Tru1I TTAA 1 cut(s) 161
Tru9I TTAA 1 cut(s) 161
TspDTI ATGAA 3 cut(s) 35, 39, 66
VspI ATTAAT 1 cut(s) 161
XspI CTAG 1 cut(s) 83
Zsp2I ATGCAT 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.