Rmu_sc0005234.1_g000009

Arabidopsis phospholipase-like protein (PEARLI 4)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005234.1
Physical Location & Seq
Reverse (-)
39260 .. 39562
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005234.1_g000009.1.cds

Sequence Viewer

Length: 303 bp
atgctcaaggatgtagaatcttcaggattggatgttggttggcgtcgtctcatgctcgaatgtgcagaattcattaatctcgtgagtcagcatcgagcattcaaactagaaaaggccaactgtgatcacgacaacgaatcattaaggaaagaactagaagcccaaatggaggctttggctctgaaagaaaaggaggttgctgatgccaagaagcaactttctgaaactagagcctatctgagagagcttgatcagctcaaatcatctattttgcgcaagactgctaggcttgttaatttatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.56

Weight (kDa)

6.74

Isoelectric Point (pI)

37.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 275
AcsI RAATTY 1 cut(s) 68
AcuI CTGAAG 1 cut(s) 6
AcyI GRCGYC 1 cut(s) 43
AfiI CCNNNNNNNGG 1 cut(s) 169
AgsI TTSAA 1 cut(s) 103
AluBI AGCT 2 cut(s) 247, 256
AluI AGCT 2 cut(s) 247, 256
Alw26I GTCTC 1 cut(s) 53
AoxI GGCC 1 cut(s) 114
ApoI RAATTY 1 cut(s) 68
AseI ATTAAT 1 cut(s) 75
AspLEI GCGC 1 cut(s) 276
BauI CACGAG 1 cut(s) 80
BclI TGATCA 2 cut(s) 124, 250
BcoDI GTCTC 1 cut(s) 53
BfaI CTAG 4 cut(s) 107, 155, 228, 285
BmsI GCATC 2 cut(s) 100, 193
BsaHI GRCGYC 1 cut(s) 43
Bsc4I CCNNNNNNNGG 1 cut(s) 169
BseGI GGATG 2 cut(s) 16, 37
BseLI CCNNNNNNNGG 1 cut(s) 169
BseMII CTCAG 1 cut(s) 230
BsgI GTGCAG 1 cut(s) 84
BshFI GGCC 1 cut(s) 116
BslI CCNNNNNNNGG 1 cut(s) 169
BsmAI GTCTC 1 cut(s) 53
BsmBI CGTCTC 1 cut(s) 53
BsmI GAATGC 1 cut(s) 98
BsnI GGCC 1 cut(s) 116
Bsp143I GATC 2 cut(s) 124, 250
BspANI GGCC 1 cut(s) 116
BspCNI CTCAG 1 cut(s) 231
BssMI GATC 2 cut(s) 124, 250
BssNI GRCGYC 1 cut(s) 43
BssSI CACGAG 1 cut(s) 80
Bst2BI CACGAG 1 cut(s) 80
Bst4CI ACNGT 1 cut(s) 122
BstACI GRCGYC 1 cut(s) 43
BstDEI CTNAG 1 cut(s) 239
BstF5I GGATG 2 cut(s) 16, 37
BstHHI GCGC 1 cut(s) 276
BstKTI GATC 2 cut(s) 127, 253
BstMAI GTCTC 1 cut(s) 53
BstMBI GATC 2 cut(s) 124, 250
BstMWI GCNNNNNNNGC 1 cut(s) 253
BsuRI GGCC 1 cut(s) 116
BtsCI GGATG 2 cut(s) 16, 37
CfoI GCGC 1 cut(s) 276
CseI GACGC 1 cut(s) 32
CviAII CATG 1 cut(s) 52
CviJI RGCY 8 cut(s) 116, 161, 173, 179, 233, 247, 256, 289
CviKI_1 RGCY 8 cut(s) 116, 161, 173, 179, 233, 247, 256, 289
DdeI CTNAG 1 cut(s) 239
DpnI GATC 2 cut(s) 126, 252
DpnII GATC 2 cut(s) 124, 250
Eco57I CTGAAG 1 cut(s) 6
EcoRI GAATTC 1 cut(s) 68
Esp3I CGTCTC 1 cut(s) 53
FaeI CATG 1 cut(s) 55
FaiI YATR 2 cut(s) 53, 301
FatI CATG 1 cut(s) 51
FbaI TGATCA 2 cut(s) 124, 250
FokI GGATG 2 cut(s) 23, 44
FspBI CTAG 4 cut(s) 107, 155, 228, 285
FspI TGCGCA 1 cut(s) 275
GlaI GCGC 1 cut(s) 275
HaeIII GGCC 1 cut(s) 116
HgaI GACGC 1 cut(s) 32
HhaI GCGC 1 cut(s) 276
Hin1I GRCGYC 1 cut(s) 43
Hin1II CATG 1 cut(s) 55
Hin6I GCGC 1 cut(s) 274
HinP1I GCGC 1 cut(s) 274
HinfI GANTC 3 cut(s) 17, 85, 137
Hpy188I TCNGA 3 cut(s) 183, 223, 240
Hpy188III TCNNGA 3 cut(s) 24, 82, 128
Hpy99I CGWCG 1 cut(s) 48
HpyCH4III ACNGT 1 cut(s) 122
HpyCH4V TGCA 1 cut(s) 65
HpyF10VI GCNNNNNNNGC 1 cut(s) 253
HpyF3I CTNAG 1 cut(s) 239
Hsp92I GRCGYC 1 cut(s) 43
Hsp92II CATG 1 cut(s) 55
HspAI GCGC 1 cut(s) 274
Ksp22I TGATCA 2 cut(s) 124, 250
Kzo9I GATC 2 cut(s) 124, 250
LpnPI CCDG 1 cut(s) 9
LweI GCATC 2 cut(s) 100, 193
MaeI CTAG 4 cut(s) 107, 155, 228, 285
MalI GATC 2 cut(s) 126, 252
MboI GATC 2 cut(s) 124, 250
MboII GAAGA 1 cut(s) 12
MluCI AATT 2 cut(s) 68, 295
MlyI GAGTC 1 cut(s) 94
MnlI CCTC 2 cut(s) 163, 187
MseI TTAA 3 cut(s) 75, 143, 294
Mva1269I GAATGC 1 cut(s) 98
MwoI GCNNNNNNNGC 1 cut(s) 253
NdeII GATC 2 cut(s) 124, 250
NlaIII CATG 1 cut(s) 55
NsbI TGCGCA 1 cut(s) 275
PctI GAATGC 1 cut(s) 98
PfeI GAWTC 2 cut(s) 17, 137
PleI GAGTC 1 cut(s) 93
PpsI GAGTC 1 cut(s) 93
PshBI ATTAAT 1 cut(s) 75
SaqAI TTAA 3 cut(s) 75, 143, 294
Sau3AI GATC 2 cut(s) 124, 250
SchI GAGTC 1 cut(s) 94
SetI ASST 3 cut(s) 198, 249, 258
SfaNI GCATC 2 cut(s) 100, 193
SmlI CTYRAG 1 cut(s) 5
SmoI CTYRAG 1 cut(s) 5
Sse9I AATT 2 cut(s) 68, 295
SspMI CTAG 4 cut(s) 107, 155, 228, 285
TaaI ACNGT 1 cut(s) 122
TaqI TCGA 2 cut(s) 57, 94
TasI AATT 2 cut(s) 68, 295
TfiI GAWTC 2 cut(s) 17, 137
Tru1I TTAA 3 cut(s) 75, 143, 294
Tru9I TTAA 3 cut(s) 75, 143, 294
TspDTI ATGAA 1 cut(s) 61
VspI ATTAAT 1 cut(s) 75
XapI RAATTY 1 cut(s) 68
XspI CTAG 4 cut(s) 107, 155, 228, 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.