Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005234.1

Orthogroup ID

OG0002091

Physical Location & Seq

Genomic Coordinates Reverse (-)

39260 .. 39562

Gene Structure 303 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005234.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 303 bp

atgctcaaggatgtagaatcttcaggattggatgttggttggcgtcgtctcatgctcgaatgtgcagaattcattaatctcgtgagtcagcatcgagcattcaaactagaaaaggccaactgtgatcacgacaacgaatcattaaggaaagaactagaagcccaaatggaggctttggctctgaaagaaaaggaggttgctgatgccaagaagcaactttctgaaactagagcctatctgagagagcttgatcagctcaaatcatctattttgcgcaagactgctaggcttgttaatttatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PEARLI-4

Protein Analysis

100

Amino Acids

11.56

Weight (kDa)

6.74

Isoelectric Point (pI)

37.92

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002091)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G16900 AT2G16900 AT2G16900 AT2G16900 AT2G16900 AT2G16900 AT2G16900 AT4G35110 AT4G35110 AT4G35110 AT4G35110 AT4G35110 AT4G35110
fragaria_vesca	FvH4_2g15450 FvH4_2g15450 FvH4_2g15450 FvH4_2g15450 FvH4_2g15450
malus_domestica	MD05G1122800.v1.1 MD10G1125400.v1.1
prunus_persica	Prupe.8G166700_v2.0.a1 Prupe.8G166700_v2.0.a1 Prupe.8G166700_v2.0.a1 Prupe.8G166700_v2.0.a1 Prupe.8G166700_v2.0.a1
pyrus_communis	pycom05g11710 pycom10g10800
rosa_chinensis	RchiOBHm_Chr6g0278421 RchiOBHm_Chr6g0278431
rosa_laevigata	RLG00000013229
rosa_multiflora	Rmu_sc0003837.1_g000016 Rmu_sc0005234.1_g000009
rosa_roxburghii	Rroxscaffold_7G00189890 Rroxscaffold_7G00190360
rosa_rugosa	Rorug06G0116900
rosa_samantha	Rh4AG317400 Rh4BG325600 Rh4CG340600 Rh4DG320800 Rh6AG226200 Rh6BG230300 Rh6CG233500 Rh6DG224800
rosa_wichuraiana	Rw6G019730

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	275
AcsI	RAATTY	1 cut(s)	68
AcuI	CTGAAG	1 cut(s)	6
AcyI	GRCGYC	1 cut(s)	43
AfiI	CCNNNNNNNGG	1 cut(s)	169
AgsI	TTSAA	1 cut(s)	103
AluBI	AGCT	2 cut(s)	247, 256
AluI	AGCT	2 cut(s)	247, 256
Alw26I	GTCTC	1 cut(s)	53
AoxI	GGCC	1 cut(s)	114
ApoI	RAATTY	1 cut(s)	68
AseI	ATTAAT	1 cut(s)	75
AspLEI	GCGC	1 cut(s)	276
BauI	CACGAG	1 cut(s)	80
BclI	TGATCA	2 cut(s)	124, 250
BcoDI	GTCTC	1 cut(s)	53
BfaI	CTAG	4 cut(s)	107, 155, 228, 285
BmsI	GCATC	2 cut(s)	100, 193
BsaHI	GRCGYC	1 cut(s)	43
Bsc4I	CCNNNNNNNGG	1 cut(s)	169
BseGI	GGATG	2 cut(s)	16, 37
BseLI	CCNNNNNNNGG	1 cut(s)	169
BseMII	CTCAG	1 cut(s)	230
BsgI	GTGCAG	1 cut(s)	84
BshFI	GGCC	1 cut(s)	116
BslI	CCNNNNNNNGG	1 cut(s)	169
BsmAI	GTCTC	1 cut(s)	53
BsmBI	CGTCTC	1 cut(s)	53
BsmI	GAATGC	1 cut(s)	98
BsnI	GGCC	1 cut(s)	116
Bsp143I	GATC	2 cut(s)	124, 250
BspANI	GGCC	1 cut(s)	116
BspCNI	CTCAG	1 cut(s)	231
BssMI	GATC	2 cut(s)	124, 250
BssNI	GRCGYC	1 cut(s)	43
BssSI	CACGAG	1 cut(s)	80
Bst2BI	CACGAG	1 cut(s)	80
Bst4CI	ACNGT	1 cut(s)	122
BstACI	GRCGYC	1 cut(s)	43
BstDEI	CTNAG	1 cut(s)	239
BstF5I	GGATG	2 cut(s)	16, 37
BstHHI	GCGC	1 cut(s)	276
BstKTI	GATC	2 cut(s)	127, 253
BstMAI	GTCTC	1 cut(s)	53
BstMBI	GATC	2 cut(s)	124, 250
BstMWI	GCNNNNNNNGC	1 cut(s)	253
BsuRI	GGCC	1 cut(s)	116
BtsCI	GGATG	2 cut(s)	16, 37
CfoI	GCGC	1 cut(s)	276
CseI	GACGC	1 cut(s)	32
CviAII	CATG	1 cut(s)	52
CviJI	RGCY	8 cut(s)	116, 161, 173, 179, 233, 247, 256, 289
CviKI_1	RGCY	8 cut(s)	116, 161, 173, 179, 233, 247, 256, 289
DdeI	CTNAG	1 cut(s)	239
DpnI	GATC	2 cut(s)	126, 252
DpnII	GATC	2 cut(s)	124, 250
Eco57I	CTGAAG	1 cut(s)	6
EcoRI	GAATTC	1 cut(s)	68
Esp3I	CGTCTC	1 cut(s)	53
FaeI	CATG	1 cut(s)	55
FaiI	YATR	2 cut(s)	53, 301
FatI	CATG	1 cut(s)	51
FbaI	TGATCA	2 cut(s)	124, 250
FokI	GGATG	2 cut(s)	23, 44
FspBI	CTAG	4 cut(s)	107, 155, 228, 285
FspI	TGCGCA	1 cut(s)	275
GlaI	GCGC	1 cut(s)	275
HaeIII	GGCC	1 cut(s)	116
HgaI	GACGC	1 cut(s)	32
HhaI	GCGC	1 cut(s)	276
Hin1I	GRCGYC	1 cut(s)	43
Hin1II	CATG	1 cut(s)	55
Hin6I	GCGC	1 cut(s)	274
HinP1I	GCGC	1 cut(s)	274
HinfI	GANTC	3 cut(s)	17, 85, 137
Hpy188I	TCNGA	3 cut(s)	183, 223, 240
Hpy188III	TCNNGA	3 cut(s)	24, 82, 128
Hpy99I	CGWCG	1 cut(s)	48
HpyCH4III	ACNGT	1 cut(s)	122
HpyCH4V	TGCA	1 cut(s)	65
HpyF10VI	GCNNNNNNNGC	1 cut(s)	253
HpyF3I	CTNAG	1 cut(s)	239
Hsp92I	GRCGYC	1 cut(s)	43
Hsp92II	CATG	1 cut(s)	55
HspAI	GCGC	1 cut(s)	274
Ksp22I	TGATCA	2 cut(s)	124, 250
Kzo9I	GATC	2 cut(s)	124, 250
LpnPI	CCDG	1 cut(s)	9
LweI	GCATC	2 cut(s)	100, 193
MaeI	CTAG	4 cut(s)	107, 155, 228, 285
MalI	GATC	2 cut(s)	126, 252
MboI	GATC	2 cut(s)	124, 250
MboII	GAAGA	1 cut(s)	12
MluCI	AATT	2 cut(s)	68, 295
MlyI	GAGTC	1 cut(s)	94
MnlI	CCTC	2 cut(s)	163, 187
MseI	TTAA	3 cut(s)	75, 143, 294
Mva1269I	GAATGC	1 cut(s)	98
MwoI	GCNNNNNNNGC	1 cut(s)	253
NdeII	GATC	2 cut(s)	124, 250
NlaIII	CATG	1 cut(s)	55
NsbI	TGCGCA	1 cut(s)	275
PctI	GAATGC	1 cut(s)	98
PfeI	GAWTC	2 cut(s)	17, 137
PleI	GAGTC	1 cut(s)	93
PpsI	GAGTC	1 cut(s)	93
PshBI	ATTAAT	1 cut(s)	75
SaqAI	TTAA	3 cut(s)	75, 143, 294
Sau3AI	GATC	2 cut(s)	124, 250
SchI	GAGTC	1 cut(s)	94
SetI	ASST	3 cut(s)	198, 249, 258
SfaNI	GCATC	2 cut(s)	100, 193
SmlI	CTYRAG	1 cut(s)	5
SmoI	CTYRAG	1 cut(s)	5
Sse9I	AATT	2 cut(s)	68, 295
SspMI	CTAG	4 cut(s)	107, 155, 228, 285
TaaI	ACNGT	1 cut(s)	122
TaqI	TCGA	2 cut(s)	57, 94
TasI	AATT	2 cut(s)	68, 295
TfiI	GAWTC	2 cut(s)	17, 137
Tru1I	TTAA	3 cut(s)	75, 143, 294
Tru9I	TTAA	3 cut(s)	75, 143, 294
TspDTI	ATGAA	1 cut(s)	61
VspI	ATTAAT	1 cut(s)	75
XapI	RAATTY	1 cut(s)	68
XspI	CTAG	4 cut(s)	107, 155, 228, 285

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.