Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005258.1

Orthogroup ID

OG0006982

Physical Location & Seq

Genomic Coordinates Reverse (-)

50654 .. 52183

Gene Structure 1530 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1074 bp

atgcatgaaatggtgcctggcaagcggttcgataggtatcacgagctgggtcaacatgcctttgggccgaagctagggctttggattgtggtgccccaacaggtagttgttgaggttggtgtttgcatagtctatatggtgacaggaggaaaatcattgaagaaagtccatgatgtgctttgtcctagctgccaagatatcaggaccacatactggattatgattttcgcttcttctcactttgtgctctcccatctccccaacttcaactcgatgtctggtatctcacttgccgcagcaatcatgtccttaagttactcaaccattgcatggacagcttcattacacaagggggtcataccagatgtggactacagctacagagccaaaagtacccctggaattatgtttaacttctttggtgggttgggtgatgtagcatttgcctatgctggtcacaatgtggttctagaaatccaagcaaccattccttcaacgccggataagccttccaagggtcccatgtggaaaggagtggttgtggcatacattgtcgtggctctatgctacttccctgttgcaattgttgggttttatatcttcggaaacagggttgaagacaacctcctcatctcactggagaaaccagcttggttaattgcagctgctaacctgtttgtcgtggttcatgtcattggaagctatcaggtatttgcaatgggggtgtttgacatgcttgaaacctttttggtcttgaaaatgaacttcaaacccagttttgtcctccgctttgttactcgaactacatatgttgcaattactatgttcattggcattgcaatccctttcttcggtggccttctcggattctttgggggatttgctttcgccccaacaacatatttccttccctgcatcatgtggcttgccatctacaaaccgaaaccattcagtctatcttggtgtgcaaactggttttgtatcattcttggcgttgctctgatgattctagctcccatcggtgcactaaggaacatcatcctccaagcgaaaacctacaagttcttctcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003333 GO:0003674 GO:0005215 GO:0005342 GO:0005575 GO:0005623 GO:0005886 GO:0006810 GO:0006811 GO:0006820 GO:0006865 GO:0008150 GO:0008509 GO:0008514 GO:0015075 GO:0015171 GO:0015318 GO:0015711 GO:0015849 GO:0016020 GO:0022857 GO:0034220 GO:0044464 GO:0046942 GO:0046943 GO:0051179 GO:0051234 GO:0055085 GO:0071702 GO:0071705 GO:0071944 GO:0098656 GO:1903825 GO:1905039

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Aa_trans

Protein Analysis

357

Amino Acids

39.61

Weight (kDa)

9.15

Isoelectric Point (pI)

29.1

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Aa_trans	PF01490	3 - 342	3.7e-82	Transmembrane amino acid transporter protein

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006982)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G24400 AT1G67640
fragaria_vesca	FvH4_4g24381 FvH4_4g24381 FvH4_4g24390
malus_domestica	MD13G1111700.v1.1 MD16G1111300.v1.1
prunus_persica	Prupe.1G233800_v2.0.a1
pyrus_communis	pycom16g09430
rosa_chinensis	RchiOBHm_Chr4g0431231 RchiOBHm_Chr4g0431241
rosa_laevigata	RLG00000006916 RLG00000006917
rosa_multiflora	Rmu_sc0005258.1_g000008 Rmu_sc0039160.1_g000001
rosa_roxburghii	Rroxscaffold_5G00372770 Rroxscaffold_5G00372780
rosa_rugosa	Rorug04G0249400 Rorug04G0249500 Rorug04G0249600
rosa_samantha	Rh4AG305500 Rh4BG312800 Rh4BG312900
rosa_wichuraiana	Rw4G026550 Rw4G026560

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	13, 91
AccB7I	CCANNNNNTGG	2 cut(s)	213, 330
AciI	CCGC	3 cut(s)	25, 294, 787
AdeI	CACNNNGTG	2 cut(s)	244, 463
AfaI	GTAC	1 cut(s)	394
AfiI	CCNNNNNNNGG	5 cut(s)	74, 213, 330, 515, 851
AflII	CTTAAG	1 cut(s)	310
AgsI	TTSAA	7 cut(s)	160, 268, 495, 617, 740, 757, 769
AjnI	CCWGG	2 cut(s)	16, 397
AjuI	GAANNNNNNNTTGG	2 cut(s)	471, 503
AluBI	AGCT	9 cut(s)	46, 73, 189, 338, 378, 650, 665, 702, 1013
AluI	AGCT	9 cut(s)	46, 73, 189, 338, 378, 650, 665, 702, 1013
Alw21I	GWGCWC	2 cut(s)	249, 1027
Alw44I	GTGCAC	1 cut(s)	1023
AoxI	GGCC	2 cut(s)	65, 856
ApaLI	GTGCAC	1 cut(s)	1023
ApeKI	GCWGC	4 cut(s)	189, 296, 662, 665
Asp700I	GAANNNNTTC	1 cut(s)	947
AspS9I	GGNCC	3 cut(s)	65, 204, 518
AsuHPI	GGTGA	2 cut(s)	151, 443
AvaII	GGWCC	2 cut(s)	204, 518
BaeGI	GKGCMC	2 cut(s)	96, 1027
BanI	GGYRCC	2 cut(s)	13, 91
BauI	CACGAG	1 cut(s)	41
BbsI	GAAGAC	1 cut(s)	624
Bbv12I	GWGCWC	2 cut(s)	249, 1027
BbvI	GCAGC	4 cut(s)	176, 308, 652, 674
BccI	CCATC	3 cut(s)	261, 938, 1025
BcgI	CGANNNNNNTGC	2 cut(s)	10, 44
BciT130I	CCWGG	2 cut(s)	18, 399
BfaI	CTAG	4 cut(s)	74, 186, 470, 1010
BfmI	CTRYAG	2 cut(s)	373, 379
BfrI	CTTAAG	1 cut(s)	310
BisI	GCNGC	5 cut(s)	190, 294, 297, 663, 666
BlsI	GCNGC	5 cut(s)	191, 295, 298, 664, 667
Bme1390I	CCNGG	2 cut(s)	18, 399
Bme18I	GGWCC	2 cut(s)	204, 518
BmgT120I	GGNCC	3 cut(s)	65, 204, 518
BmiI	GGNNCC	4 cut(s)	15, 93, 519, 520
BmrFI	CCNGG	2 cut(s)	18, 399
BmrI	ACTGGG	1 cut(s)	768
BmsI	GCATC	1 cut(s)	924
BmuI	ACTGGG	1 cut(s)	768
BpiI	GAAGAC	1 cut(s)	624
BpmI	CTGGAG	1 cut(s)	659
BsaBI	GATNNNNATC	1 cut(s)	36
BsaJI	CCNNGG	2 cut(s)	397, 513
BsaXI	ACNNNNNCTCC	2 cut(s)	525, 555
Bsc4I	CCNNNNNNNGG	5 cut(s)	74, 213, 330, 515, 851
Bse1I	ACTGG	4 cut(s)	218, 642, 774, 977
Bse3DI	GCAATG	3 cut(s)	324, 723, 834
Bse8I	GATNNNNATC	1 cut(s)	36
BseBI	CCWGG	2 cut(s)	18, 399
BseDI	CCNNGG	2 cut(s)	397, 513
BseGI	GGATG	1 cut(s)	1038
BseJI	GATNNNNATC	1 cut(s)	36
BseLI	CCNNNNNNNGG	5 cut(s)	74, 213, 330, 515, 851
BseMI	GCAATG	3 cut(s)	324, 723, 834
BseNI	ACTGG	4 cut(s)	218, 642, 774, 977
BseRI	GAGGAG	1 cut(s)	617
BseSI	GKGCMC	2 cut(s)	96, 1027
BseXI	GCAGC	4 cut(s)	176, 308, 652, 674
BseYI	CCCAGC	1 cut(s)	46
BshFI	GGCC	2 cut(s)	67, 858
BshNI	GGYRCC	2 cut(s)	13, 91
BsiHKAI	GWGCWC	2 cut(s)	249, 1027
BsiSI	CCGG	1 cut(s)	500
BslFI	GGGAC	1 cut(s)	504
BslI	CCNNNNNNNGG	5 cut(s)	74, 213, 330, 515, 851
BsmFI	GGGAC	1 cut(s)	504
BsnI	GGCC	2 cut(s)	67, 858
Bsp1286I	GDGCHC	3 cut(s)	96, 249, 1027
BspACI	CCGC	3 cut(s)	25, 294, 787
BspANI	GGCC	2 cut(s)	67, 858
BspLI	GGNNCC	4 cut(s)	15, 93, 519, 520
BspT107I	GGYRCC	2 cut(s)	13, 91
BspTI	CTTAAG	1 cut(s)	310
BsrDI	GCAATG	3 cut(s)	324, 723, 834
BsrI	ACTGG	4 cut(s)	218, 642, 774, 977
BssECI	CCNNGG	2 cut(s)	397, 513
BssSI	CACGAG	1 cut(s)	41
BssT1I	CCWWGG	1 cut(s)	513
Bst2BI	CACGAG	1 cut(s)	41
Bst2UI	CCWGG	2 cut(s)	18, 399
BstAFI	CTTAAG	1 cut(s)	310
BstC8I	GCNNGC	2 cut(s)	23, 927
BstDEI	CTNAG	1 cut(s)	1028
BstF5I	GGATG	1 cut(s)	1038
BstMWI	GCNNNNNNNGC	3 cut(s)	22, 335, 505
BstNI	CCWGG	2 cut(s)	18, 399
BstNSI	RCATGY	2 cut(s)	59, 736
BstSCI	CCNGG	2 cut(s)	16, 397
BstSFI	CTRYAG	2 cut(s)	373, 379
BstSLI	GKGCMC	2 cut(s)	96, 1027
BstV1I	GCAGC	4 cut(s)	176, 308, 652, 674
BstV2I	GAAGAC	1 cut(s)	624
BsuRI	GGCC	2 cut(s)	67, 858
BtsCI	GGATG	1 cut(s)	1038
BtsIMutI	CAGTG	1 cut(s)	635
Cac8I	GCNNGC	2 cut(s)	23, 927
Cfr13I	GGNCC	3 cut(s)	65, 204, 518
Csp6I	GTAC	1 cut(s)	393
CviAII	CATG	9 cut(s)	5, 56, 170, 304, 330, 523, 689, 733, 919
CviQI	GTAC	1 cut(s)	393
DdeI	CTNAG	1 cut(s)	1028
DraIII	CACNNNGTG	2 cut(s)	244, 463
Eco130I	CCWWGG	1 cut(s)	513
Eco32I	GATATC	1 cut(s)	199
Eco47I	GGWCC	2 cut(s)	204, 518
EcoO109I	RGGNCCY	1 cut(s)	518
EcoRII	CCWGG	2 cut(s)	16, 397
EcoRV	GATATC	1 cut(s)	199
EcoT14I	CCWWGG	1 cut(s)	513
EcoT22I	ATGCAT	1 cut(s)	6
ErhI	CCWWGG	1 cut(s)	513
FaeI	CATG	9 cut(s)	8, 59, 173, 307, 333, 526, 692, 736, 922
FaqI	GGGAC	1 cut(s)	504
FatI	CATG	9 cut(s)	4, 55, 169, 303, 329, 522, 688, 732, 918
FauNDI	CATATG	1 cut(s)	808
Fnu4HI	GCNGC	5 cut(s)	190, 294, 297, 663, 666
FokI	GGATG	1 cut(s)	1025
Fsp4HI	GCNGC	5 cut(s)	190, 294, 297, 663, 666
FspBI	CTAG	4 cut(s)	74, 186, 470, 1010
GluI	GCNGC	5 cut(s)	190, 294, 297, 663, 666
GsaI	CCCAGC	1 cut(s)	50
GsuI	CTGGAG	1 cut(s)	659
HaeIII	GGCC	2 cut(s)	67, 858
HapII	CCGG	1 cut(s)	500
Hin1II	CATG	9 cut(s)	8, 59, 173, 307, 333, 526, 692, 736, 922
HincII	GTYRAC	1 cut(s)	53
HindII	GTYRAC	1 cut(s)	53
HinfI	GANTC	2 cut(s)	867, 1006
HpaII	CCGG	1 cut(s)	500
HphI	GGTGA	2 cut(s)	151, 443
Hpy166II	GTNNAC	3 cut(s)	53, 370, 1025
Hpy188I	TCNGA	3 cut(s)	605, 866, 1002
Hpy188III	TCNNGA	4 cut(s)	41, 202, 470, 754
Hpy8I	GTNNAC	3 cut(s)	53, 370, 1025
HpyAV	CCTTC	4 cut(s)	501, 519, 869, 917
HpyF10VI	GCNNNNNNNGC	3 cut(s)	22, 335, 505
HpyF3I	CTNAG	1 cut(s)	1028
Hsp92II	CATG	9 cut(s)	8, 59, 173, 307, 333, 526, 692, 736, 922
KflI	GGGWCCC	1 cut(s)	518
LmnI	GCTCC	1 cut(s)	1018
Lsp1109I	GCAGC	4 cut(s)	176, 308, 652, 674
LweI	GCATC	1 cut(s)	924
MaeI	CTAG	4 cut(s)	74, 186, 470, 1010
MaeIII	GTNAC	4 cut(s)	139, 314, 455, 793
MboII	GAAGA	6 cut(s)	172, 225, 592, 629, 841, 1057
MfeI	CAATTG	1 cut(s)	582
MhlI	GDGCHC	3 cut(s)	96, 249, 1027
MluCI	AATT	4 cut(s)	402, 582, 657, 816
MnlI	CCTC	6 cut(s)	106, 140, 635, 638, 794, 1052
Mph1103I	ATGCAT	1 cut(s)	6
MroXI	GAANNNNTTC	1 cut(s)	947
MseI	TTAA	4 cut(s)	311, 411, 656, 1072
MslI	CAYNNNNRTG	1 cut(s)	554
MspA1I	CMGCKG	1 cut(s)	665
MspCI	CTTAAG	1 cut(s)	310
MspI	CCGG	1 cut(s)	500
MspR9I	CCNGG	2 cut(s)	18, 399
MunI	CAATTG	1 cut(s)	582
MvaI	CCWGG	2 cut(s)	18, 399
MwoI	GCNNNNNNNGC	3 cut(s)	22, 335, 505
NdeI	CATATG	1 cut(s)	808
NlaIII	CATG	9 cut(s)	8, 59, 173, 307, 333, 526, 692, 736, 922
NlaIV	GGNNCC	4 cut(s)	15, 93, 519, 520
NmuCI	GTSAC	2 cut(s)	139, 455
NsiI	ATGCAT	1 cut(s)	6
NspI	RCATGY	2 cut(s)	59, 736
PdmI	GAANNNNTTC	1 cut(s)	947
PfeI	GAWTC	2 cut(s)	867, 1006
PflMI	CCANNNNNTGG	2 cut(s)	213, 330
PkrI	GCNGC	5 cut(s)	191, 295, 298, 664, 667
PpuMI	RGGWCCY	1 cut(s)	518
Psp5II	RGGWCCY	1 cut(s)	518
Psp6I	CCWGG	2 cut(s)	16, 397
PspFI	CCCAGC	1 cut(s)	46
PspGI	CCWGG	2 cut(s)	16, 397
PspN4I	GGNNCC	4 cut(s)	15, 93, 519, 520
PspPI	GGNCC	3 cut(s)	65, 204, 518
PspPPI	RGGWCCY	1 cut(s)	518
PvuII	CAGCTG	1 cut(s)	665
RsaI	GTAC	1 cut(s)	394
RsaNI	GTAC	1 cut(s)	393
RseI	CAYNNNNRTG	1 cut(s)	554
SaqAI	TTAA	4 cut(s)	311, 411, 656, 1072
SatI	GCNGC	5 cut(s)	190, 294, 297, 663, 666
Sau96I	GGNCC	3 cut(s)	65, 204, 518
ScrFI	CCNGG	2 cut(s)	18, 399
SduI	GDGCHC	3 cut(s)	96, 249, 1027
SfaNI	GCATC	1 cut(s)	924
SfcI	CTRYAG	2 cut(s)	373, 379
SinI	GGWCC	2 cut(s)	204, 518
SmiMI	CAYNNNNRTG	1 cut(s)	554
SmlI	CTYRAG	1 cut(s)	310
SmoI	CTYRAG	1 cut(s)	310
Sse9I	AATT	4 cut(s)	402, 582, 657, 816
SsiI	CCGC	3 cut(s)	25, 294, 787
SspMI	CTAG	4 cut(s)	74, 186, 470, 1010
StyD4I	CCNGG	2 cut(s)	16, 397
StyI	CCWWGG	1 cut(s)	513
TaqI	TCGA	3 cut(s)	30, 272, 799
TasI	AATT	4 cut(s)	402, 582, 657, 816
TauI	GCSGC	1 cut(s)	296
TfiI	GAWTC	2 cut(s)	867, 1006
Tru1I	TTAA	4 cut(s)	311, 411, 656, 1072
Tru9I	TTAA	4 cut(s)	311, 411, 656, 1072
TscAI	CASTG	1 cut(s)	642
TseFI	GTSAC	2 cut(s)	139, 455
TseI	GCWGC	4 cut(s)	189, 296, 662, 665
Tsp45I	GTSAC	2 cut(s)	139, 455
TspDTI	ATGAA	5 cut(s)	21, 330, 677, 776, 817
TspRI	CASTG	1 cut(s)	642
Van91I	CCANNNNNTGG	2 cut(s)	213, 330
Vha464I	CTTAAG	1 cut(s)	310
VneI	GTGCAC	1 cut(s)	1023
VpaK11BI	GGWCC	2 cut(s)	204, 518
XbaI	TCTAGA	1 cut(s)	469
XceI	RCATGY	2 cut(s)	59, 736
XmnI	GAANNNNTTC	1 cut(s)	947
XspI	CTAG	4 cut(s)	74, 186, 470, 1010
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.