Rmu_sc0006047.1_g000002

Component of the coenzyme Q biosynthetic pathway. May play a role in organizing a multi-subunit COQ enzyme complex required for coenzyme Q biosynthesis. Required for steady-state levels of other COQ polypeptides

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006047.1
OG0005151
Physical Location & Seq
Forward (+)
13484 .. 14499
1016 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 504 bp
atgaagttgtggggaagagcgttgaggaagggcgtgagagtggccatactgtcggagcaaccccgtgtaatatctgcaaatgtgggtcatgcatgggatcttccgccgaatacatttggtgctgcctatgcgaagttcatgggatctaggaacttctctccagataatcgaccaccagtgcgtttcatggaaatagatgaacttgcatatgtagccatgagggctcgtgaggtgcacgacttctggcacaccctctttaaccttccaacaaacttgatgggtgagtcagcacttaaagtaatagagtttcagcaaatgtaccttcccatgtgcttgatgtccgttatagggggctctgtgaggttcaatgagaagcaaagaaaaatgttcttccagcactactttccttgggccattagagttggtatgctgtcaaccgatctcatgtgtatttattatgagaaacactttcatgaggatttggaggatgttcggagaaattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Coq4

Protein Analysis

167

Amino Acids

19.62

Weight (kDa)

9.2

Isoelectric Point (pI)

47.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Coq4 PF05019 15 - 166 1.2e-58 Coenzyme Q (ubiquinone) biosynthesis protein Coq4
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 104
AclWI GGATC 2 cut(s) 105, 151
AcoI YGGCCR 1 cut(s) 42
AfaI GTAC 1 cut(s) 320
AfiI CCNNNNNNNGG 1 cut(s) 348
AgsI TTSAA 1 cut(s) 367
Alw21I GWGCWC 1 cut(s) 237
Alw44I GTGCAC 1 cut(s) 233
AlwI GGATC 2 cut(s) 105, 151
AoxI GGCC 2 cut(s) 42, 411
ApaLI GTGCAC 1 cut(s) 233
ApeKI GCWGC 1 cut(s) 122
AspS9I GGNCC 1 cut(s) 411
AsuHPI GGTGA 1 cut(s) 293
BaeGI GKGCMC 1 cut(s) 237
BalI TGGCCA 1 cut(s) 44
BanII GRGCYC 2 cut(s) 226, 356
BauI CACGAG 1 cut(s) 225
Bbv12I GWGCWC 1 cut(s) 237
BbvI GCAGC 1 cut(s) 109
BccI CCATC 1 cut(s) 271
BfaI CTAG 1 cut(s) 147
BglI GCCNNNNNGGC 1 cut(s) 221
BisI GCNGC 1 cut(s) 123
BlsI GCNGC 1 cut(s) 124
BmgT120I GGNCC 1 cut(s) 411
BpmI CTGGAG 1 cut(s) 144
BsaJI CCNNGG 1 cut(s) 407
Bsc4I CCNNNNNNNGG 1 cut(s) 348
Bse1I ACTGG 1 cut(s) 176
BseDI CCNNGG 1 cut(s) 407
BseGI GGATG 1 cut(s) 493
BseLI CCNNNNNNNGG 1 cut(s) 348
BseNI ACTGG 1 cut(s) 176
BseSI GKGCMC 1 cut(s) 237
BseXI GCAGC 1 cut(s) 109
BshFI GGCC 2 cut(s) 44, 413
BsiHKAI GWGCWC 1 cut(s) 237
BslI CCNNNNNNNGG 1 cut(s) 348
BsnI GGCC 2 cut(s) 44, 413
Bsp1286I GDGCHC 3 cut(s) 226, 237, 356
Bsp143I GATC 3 cut(s) 97, 143, 439
BspACI CCGC 1 cut(s) 104
BspANI GGCC 2 cut(s) 44, 413
BspHI TCATGA 1 cut(s) 472
BspPI GGATC 2 cut(s) 105, 151
BspQI GCTCTTC 1 cut(s) 10
BsrI ACTGG 1 cut(s) 176
BssECI CCNNGG 1 cut(s) 407
BssMI GATC 3 cut(s) 97, 143, 439
BssSI CACGAG 1 cut(s) 225
BssT1I CCWWGG 1 cut(s) 407
Bst2BI CACGAG 1 cut(s) 225
Bst4CI ACNGT 1 cut(s) 51
Bst6I CTCTTC 1 cut(s) 10
BstF5I GGATG 1 cut(s) 493
BstKTI GATC 3 cut(s) 100, 146, 442
BstMBI GATC 3 cut(s) 97, 143, 439
BstMWI GCNNNNNNNGC 3 cut(s) 128, 212, 221
BstSLI GKGCMC 1 cut(s) 237
BstV1I GCAGC 1 cut(s) 109
BstX2I RGATCY 2 cut(s) 97, 143
BstYI RGATCY 2 cut(s) 97, 143
BsuRI GGCC 2 cut(s) 44, 413
BtsCI GGATG 1 cut(s) 493
BtsIMutI CAGTG 1 cut(s) 183
CciI TCATGA 1 cut(s) 472
Cfr13I GGNCC 1 cut(s) 411
Csp6I GTAC 1 cut(s) 319
CviAII CATG 8 cut(s) 89, 93, 139, 187, 217, 328, 445, 473
CviJI RGCY 5 cut(s) 44, 215, 224, 354, 413
CviKI_1 RGCY 5 cut(s) 44, 215, 224, 354, 413
CviQI GTAC 1 cut(s) 319
DpnI GATC 3 cut(s) 99, 145, 441
DpnII GATC 3 cut(s) 97, 143, 439
EaeI YGGCCR 1 cut(s) 42
Eam1104I CTCTTC 1 cut(s) 10
EarI CTCTTC 1 cut(s) 10
EciI GGCGGA 1 cut(s) 93
Eco130I CCWWGG 1 cut(s) 407
Eco24I GRGCYC 2 cut(s) 226, 356
EcoT14I CCWWGG 1 cut(s) 407
EcoT22I ATGCAT 1 cut(s) 94
EcoT38I GRGCYC 2 cut(s) 226, 356
ErhI CCWWGG 1 cut(s) 407
FaeI CATG 8 cut(s) 92, 96, 142, 190, 220, 331, 448, 476
FatI CATG 8 cut(s) 88, 92, 138, 186, 216, 327, 444, 472
FauNDI CATATG 1 cut(s) 208
Fnu4HI GCNGC 1 cut(s) 123
FokI GGATG 1 cut(s) 500
FriOI GRGCYC 2 cut(s) 226, 356
Fsp4HI GCNGC 1 cut(s) 123
FspBI CTAG 1 cut(s) 147
GluI GCNGC 1 cut(s) 123
GsuI CTGGAG 1 cut(s) 144
HaeIII GGCC 2 cut(s) 44, 413
Hin1II CATG 8 cut(s) 92, 96, 142, 190, 220, 331, 448, 476
HincII GTYRAC 1 cut(s) 435
HindII GTYRAC 1 cut(s) 435
HinfI GANTC 1 cut(s) 284
HphI GGTGA 1 cut(s) 293
Hpy166II GTNNAC 2 cut(s) 235, 435
Hpy188I TCNGA 2 cut(s) 55, 495
Hpy188III TCNNGA 3 cut(s) 161, 227, 473
Hpy8I GTNNAC 2 cut(s) 235, 435
HpyAV CCTTC 3 cut(s) 22, 272, 332
HpyCH4III ACNGT 1 cut(s) 51
HpyCH4V TGCA 4 cut(s) 77, 92, 206, 235
HpyF10VI GCNNNNNNNGC 3 cut(s) 128, 212, 221
Hsp92II CATG 8 cut(s) 92, 96, 142, 190, 220, 331, 448, 476
Kzo9I GATC 3 cut(s) 97, 143, 439
LguI GCTCTTC 1 cut(s) 10
LmnI GCTCC 1 cut(s) 55
LpnPI CCDG 4 cut(s) 174, 189, 229, 407
Lsp1109I GCAGC 1 cut(s) 109
MaeI CTAG 1 cut(s) 147
MalI GATC 3 cut(s) 99, 145, 441
MboI GATC 3 cut(s) 97, 143, 439
MboII GAAGA 3 cut(s) 27, 92, 382
MflI RGATCY 2 cut(s) 97, 143
MhlI GDGCHC 3 cut(s) 226, 237, 356
MlsI TGGCCA 1 cut(s) 44
MluCI AATT 1 cut(s) 499
MluNI TGGCCA 1 cut(s) 44
MlyI GAGTC 1 cut(s) 293
MmeI TCCRAC 2 cut(s) 33, 290
MnlI CCTC 7 cut(s) 18, 213, 223, 263, 354, 469, 478
Mox20I TGGCCA 1 cut(s) 44
Mph1103I ATGCAT 1 cut(s) 94
MscI TGGCCA 1 cut(s) 44
MseI TTAA 2 cut(s) 258, 294
MslI CAYNNNNRTG 1 cut(s) 471
Msp20I TGGCCA 1 cut(s) 44
MwoI GCNNNNNNNGC 3 cut(s) 128, 212, 221
NdeI CATATG 1 cut(s) 208
NdeII GATC 3 cut(s) 97, 143, 439
NlaIII CATG 8 cut(s) 92, 96, 142, 190, 220, 331, 448, 476
NsiI ATGCAT 1 cut(s) 94
PagI TCATGA 1 cut(s) 472
PciSI GCTCTTC 1 cut(s) 10
PkrI GCNGC 1 cut(s) 124
PleI GAGTC 1 cut(s) 292
PpsI GAGTC 1 cut(s) 292
PspPI GGNCC 1 cut(s) 411
PsuI RGATCY 2 cut(s) 97, 143
RsaI GTAC 1 cut(s) 320
RsaNI GTAC 1 cut(s) 319
RseI CAYNNNNRTG 1 cut(s) 471
SapI GCTCTTC 1 cut(s) 10
SaqAI TTAA 2 cut(s) 258, 294
SatI GCNGC 1 cut(s) 123
Sau3AI GATC 3 cut(s) 97, 143, 439
Sau96I GGNCC 1 cut(s) 411
SchI GAGTC 1 cut(s) 293
SduI GDGCHC 3 cut(s) 226, 237, 356
SetI ASST 4 cut(s) 234, 264, 324, 365
SmiMI CAYNNNNRTG 1 cut(s) 471
Sse9I AATT 1 cut(s) 499
SsiI CCGC 1 cut(s) 104
SspMI CTAG 1 cut(s) 147
StyI CCWWGG 1 cut(s) 407
TaaI ACNGT 1 cut(s) 51
TaqI TCGA 1 cut(s) 169
TasI AATT 1 cut(s) 499
Tru1I TTAA 2 cut(s) 258, 294
Tru9I TTAA 2 cut(s) 258, 294
TscAI CASTG 1 cut(s) 183
TseI GCWGC 1 cut(s) 122
TspDTI ATGAA 5 cut(s) 17, 127, 175, 213, 461
TspGWI ACGGA 1 cut(s) 331
TspRI CASTG 1 cut(s) 183
VneI GTGCAC 1 cut(s) 233
XspI CTAG 1 cut(s) 147
Zsp2I ATGCAT 1 cut(s) 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.