Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006315.1

Orthogroup ID

OG0009723

Physical Location & Seq

Genomic Coordinates Reverse (-)

58995 .. 59318

Gene Structure 324 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006315.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 324 bp

atgaaattcccagcaatttgtcctttcaaaaccctccatgttcccgccaattttacagcaaagccaaagcatcacgtccaaaaacttctcggaaagatctccggccactccaaacccaaccacattggaaattccgttcaagtcttgacgaaaaatagtagtagcttctcaatctcgacgacgttcaaggacgagatagagcaagaattggagaattcgagcagcgataagagttggattcacttagtgggaattggaggctgtggattgtctgcgctggccatgcttgcactcaaacatgtaaagcttgatttcaagccctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Mur_ligase Mur_ligase_C Mur_ligase_M

Protein Analysis

107

Amino Acids

11.68

Weight (kDa)

9.56

Isoelectric Point (pI)

28.43

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009723)

Species	Orthologous Gene IDs
malus_domestica	MD01G1208200.v1.1 MD07G1278800.v1.1
prunus_persica	Prupe.2G300700_v2.0.a1
pyrus_communis	pycom01g21880
rosa_chinensis	RchiOBHm_Chr1g0378261
rosa_laevigata	RLG00000026454 RLG00000026455
rosa_multiflora	Rmu_sc0006315.1_g000004 Rmu_sc0006315.1_g000010 Rmu_sc0013545.1_g000004
rosa_roxburghii	Rroxscaffold_4G00280540 Rroxscaffold_4G00280550 Rroxscaffold_4G00280600
rosa_rugosa	Rorug01G0407600 Rorug01G0407800
rosa_samantha	Rh1AG421700 Rh1AG422200 Rh1BG386900 Rh1CG400400 Rh1DG418000
rosa_wichuraiana	Rw0G013300 Rw1G037520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	45
AcoI	YGGCCR	2 cut(s)	103, 279
AcsI	RAATTY	3 cut(s)	5, 130, 214
AdeI	CACNNNGTG	1 cut(s)	247
AflIII	ACRYGT	1 cut(s)	298
AgsI	TTSAA	4 cut(s)	28, 140, 187, 316
AjiI	CACGTC	1 cut(s)	76
AloI	GAACNNNNNNTCC	2 cut(s)	120, 152
AluBI	AGCT	2 cut(s)	165, 307
AluI	AGCT	2 cut(s)	165, 307
AoxI	GGCC	2 cut(s)	103, 279
ApeKI	GCWGC	1 cut(s)	222
ApoI	RAATTY	3 cut(s)	5, 130, 214
AspLEI	GCGC	1 cut(s)	277
BalI	TGGCCA	1 cut(s)	281
BbvI	GCAGC	1 cut(s)	234
BglII	AGATCT	1 cut(s)	96
BisI	GCNGC	1 cut(s)	223
BlsI	GCNGC	1 cut(s)	224
BmgBI	CACGTC	1 cut(s)	76
BmsI	GCATC	1 cut(s)	79
BseXI	GCAGC	1 cut(s)	234
BseYI	CCCAGC	1 cut(s)	10
BshFI	GGCC	2 cut(s)	105, 281
BsiSI	CCGG	1 cut(s)	102
BsnI	GGCC	2 cut(s)	105, 281
Bsp143I	GATC	1 cut(s)	96
BspACI	CCGC	1 cut(s)	45
BspANI	GGCC	2 cut(s)	105, 281
BssMI	GATC	1 cut(s)	96
BstC8I	GCNNGC	2 cut(s)	279, 288
BstDEI	CTNAG	1 cut(s)	244
BstHHI	GCGC	1 cut(s)	277
BstKTI	GATC	1 cut(s)	99
BstMBI	GATC	1 cut(s)	96
BstMWI	GCNNNNNNNGC	2 cut(s)	283, 287
BstNSI	RCATGY	1 cut(s)	302
BstV1I	GCAGC	1 cut(s)	234
BstX2I	RGATCY	1 cut(s)	96
BstYI	RGATCY	1 cut(s)	96
BsuRI	GGCC	2 cut(s)	105, 281
BtrI	CACGTC	1 cut(s)	76
Cac8I	GCNNGC	2 cut(s)	279, 288
CfoI	GCGC	1 cut(s)	277
CviAII	CATG	3 cut(s)	38, 283, 299
CviJI	RGCY	7 cut(s)	64, 105, 165, 261, 281, 307, 319
CviKI_1	RGCY	7 cut(s)	64, 105, 165, 261, 281, 307, 319
DdeI	CTNAG	1 cut(s)	244
DpnI	GATC	1 cut(s)	98
DpnII	GATC	1 cut(s)	96
DraIII	CACNNNGTG	1 cut(s)	247
EaeI	YGGCCR	2 cut(s)	103, 279
EcoRI	GAATTC	1 cut(s)	214
FaeI	CATG	3 cut(s)	41, 286, 302
FaiI	YATR	3 cut(s)	39, 284, 300
FatI	CATG	3 cut(s)	37, 282, 298
FauI	CCCGC	1 cut(s)	52
Fnu4HI	GCNGC	1 cut(s)	223
Fsp4HI	GCNGC	1 cut(s)	223
GlaI	GCGC	1 cut(s)	276
GluI	GCNGC	1 cut(s)	223
GsaI	CCCAGC	1 cut(s)	14
HaeIII	GGCC	2 cut(s)	105, 281
HapII	CCGG	1 cut(s)	102
HhaI	GCGC	1 cut(s)	277
Hin1II	CATG	3 cut(s)	41, 286, 302
Hin6I	GCGC	1 cut(s)	275
HinP1I	GCGC	1 cut(s)	275
HindIII	AAGCTT	1 cut(s)	305
HinfI	GANTC	1 cut(s)	238
HpaII	CCGG	1 cut(s)	102
Hpy188I	TCNGA	1 cut(s)	92
Hpy188III	TCNNGA	2 cut(s)	145, 175
Hpy99I	CGWCG	2 cut(s)	181, 184
HpyCH4IV	ACGT	2 cut(s)	75, 182
HpyCH4V	TGCA	1 cut(s)	290
HpyF10VI	GCNNNNNNNGC	2 cut(s)	283, 287
HpyF3I	CTNAG	1 cut(s)	244
HpySE526I	ACGT	2 cut(s)	75, 182
Hsp92II	CATG	3 cut(s)	41, 286, 302
HspAI	GCGC	1 cut(s)	275
Kzo9I	GATC	1 cut(s)	96
LpnPI	CCDG	3 cut(s)	24, 115, 263
Lsp1109I	GCAGC	1 cut(s)	234
LweI	GCATC	1 cut(s)	79
MaeII	ACGT	2 cut(s)	75, 182
MalI	GATC	1 cut(s)	98
MboI	GATC	1 cut(s)	96
MflI	RGATCY	1 cut(s)	96
MlsI	TGGCCA	1 cut(s)	281
MluCI	AATT	7 cut(s)	5, 15, 49, 130, 206, 214, 252
MluNI	TGGCCA	1 cut(s)	281
MmeI	TCCRAC	1 cut(s)	215
MnlI	CCTC	2 cut(s)	44, 251
Mox20I	TGGCCA	1 cut(s)	281
MscI	TGGCCA	1 cut(s)	281
Msp20I	TGGCCA	1 cut(s)	281
MspI	CCGG	1 cut(s)	102
MwoI	GCNNNNNNNGC	2 cut(s)	283, 287
NdeII	GATC	1 cut(s)	96
NlaIII	CATG	3 cut(s)	41, 286, 302
NspI	RCATGY	1 cut(s)	302
PciI	ACATGT	1 cut(s)	298
PfeI	GAWTC	1 cut(s)	238
PkrI	GCNGC	1 cut(s)	224
PscI	ACATGT	1 cut(s)	298
PspFI	CCCAGC	1 cut(s)	10
PsuI	RGATCY	1 cut(s)	96
SatI	GCNGC	1 cut(s)	223
Sau3AI	GATC	1 cut(s)	96
SetI	ASST	4 cut(s)	78, 167, 185, 309
SfaNI	GCATC	1 cut(s)	79
Sse9I	AATT	7 cut(s)	5, 15, 49, 130, 206, 214, 252
SsiI	CCGC	1 cut(s)	45
TaiI	ACGT	2 cut(s)	78, 185
TaqI	TCGA	2 cut(s)	176, 218
TasI	AATT	7 cut(s)	5, 15, 49, 130, 206, 214, 252
TfiI	GAWTC	1 cut(s)	238
TseI	GCWGC	1 cut(s)	222
TspDTI	ATGAA	1 cut(s)	17
TspGWI	ACGGA	1 cut(s)	124
XapI	RAATTY	3 cut(s)	5, 130, 214
XceI	RCATGY	1 cut(s)	302

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.