Rroxscaffold_4G00280550

Mur ligase family, catalytic domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
3083241 .. 3085353
2113 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00280550.1

Sequence Viewer

Length: 168 bp
ATGTTTTATATCGCTCATTCAATGAGAAATATACGAAGGAGCAGTGCCTCAAGATTACCAGACGCCGTTGTTGTTTCAAGTGCTATATCTGAAGACAATGTGGAGAATTTGTATGCAGTTGGTCGGAATTCCCGTGTGAGTACATCTCTATTTGCGTGTATGGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.08

Weight (kDa)

9.3

Isoelectric Point (pI)

83.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 106, 127
AcuI CTGAAG 1 cut(s) 111
AcyI GRCGYC 1 cut(s) 63
AfaI GTAC 1 cut(s) 142
AgsI TTSAA 2 cut(s) 21, 78
ApoI RAATTY 2 cut(s) 106, 127
BbsI GAAGAC 1 cut(s) 99
BceAI ACGGC 1 cut(s) 50
BpiI GAAGAC 1 cut(s) 99
BplI GAGNNNNNCTC 2 cut(s) 130, 162
BpuEI CTTGAG 1 cut(s) 34
BsaHI GRCGYC 1 cut(s) 63
BsaXI ACNNNNNCTCC 2 cut(s) 95, 125
BssNI GRCGYC 1 cut(s) 63
BstACI GRCGYC 1 cut(s) 63
BstV2I GAAGAC 1 cut(s) 99
BtsI GCAGTG 1 cut(s) 49
BtsIMutI CAGTG 1 cut(s) 49
CseI GACGC 1 cut(s) 71
Csp6I GTAC 1 cut(s) 141
CviQI GTAC 1 cut(s) 141
Eco57I CTGAAG 1 cut(s) 111
EcoRI GAATTC 1 cut(s) 127
FaiI YATR 5 cut(s) 9, 32, 86, 114, 161
HgaI GACGC 1 cut(s) 71
Hin1I GRCGYC 1 cut(s) 63
Hpy188I TCNGA 2 cut(s) 91, 126
Hpy188III TCNNGA 1 cut(s) 51
HpyAV CCTTC 1 cut(s) 30
HpyCH4V TGCA 1 cut(s) 116
Hsp92I GRCGYC 1 cut(s) 63
LmnI GCTCC 1 cut(s) 39
LpnPI CCDG 1 cut(s) 72
MboII GAAGA 1 cut(s) 104
MluCI AATT 2 cut(s) 106, 127
MmeI TCCRAC 1 cut(s) 104
MnlI CCTC 1 cut(s) 58
PcsI WCGNNNNNNNCGW 1 cut(s) 130
RsaI GTAC 1 cut(s) 142
RsaNI GTAC 1 cut(s) 141
SgeI CNNG 5 cut(s) 63, 71, 90, 144, 146
SmlI CTYRAG 1 cut(s) 49
SmoI CTYRAG 1 cut(s) 49
Sse9I AATT 2 cut(s) 106, 127
TasI AATT 2 cut(s) 106, 127
TatI WGTACW 1 cut(s) 140
TscAI CASTG 1 cut(s) 49
TspRI CASTG 1 cut(s) 49
XapI RAATTY 2 cut(s) 106, 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.