Rroxscaffold_4G00280540

Mur ligase family, catalytic domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
3073514 .. 3075096
1583 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00280540.1

Sequence Viewer

Length: 150 bp
ATGTTTTATATCGCTCATTCAATGAGAAATATAAAAAGGAGCAGTGCCTCAAGATTACCAGACGCTGTTGTTGTTTCAAGTGCTATTCCTCAAGACAATGTGGAGAATTTGTATGCAGAGTCGGTTGGAGTTCCCGTTTCTGCTAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.33

Weight (kDa)

8.27

Isoelectric Point (pI)

74.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 106
AgsI TTSAA 2 cut(s) 21, 78
AlwNI CAGNNNCTG 1 cut(s) 65
ApoI RAATTY 1 cut(s) 106
BfaI CTAG 1 cut(s) 144
BpuEI CTTGAG 2 cut(s) 34, 75
BsaXI ACNNNNNCTCC 4 cut(s) 95, 120, 125, 150
BtsI GCAGTG 1 cut(s) 49
BtsIMutI CAGTG 1 cut(s) 49
CaiI CAGNNNCTG 1 cut(s) 65
CseI GACGC 1 cut(s) 71
FaiI YATR 3 cut(s) 9, 32, 114
FspBI CTAG 1 cut(s) 144
FspEI CC 8 cut(s) 22, 61, 72, 86, 102, 107, 111, 130
HgaI GACGC 1 cut(s) 71
HinfI GANTC 1 cut(s) 119
Hpy188III TCNNGA 2 cut(s) 51, 92
HpyCH4V TGCA 1 cut(s) 116
LmnI GCTCC 1 cut(s) 39
LpnPI CCDG 1 cut(s) 72
MaeI CTAG 1 cut(s) 144
MluCI AATT 1 cut(s) 106
MlyI GAGTC 1 cut(s) 128
MmeI TCCRAC 1 cut(s) 106
MnlI CCTC 2 cut(s) 58, 99
PleI GAGTC 1 cut(s) 127
PpsI GAGTC 1 cut(s) 127
PstNI CAGNNNCTG 1 cut(s) 65
SchI GAGTC 1 cut(s) 128
SetI ASST 1 cut(s) 149
SgeI CNNG 5 cut(s) 63, 71, 90, 104, 146
SmlI CTYRAG 2 cut(s) 49, 90
SmoI CTYRAG 2 cut(s) 49, 90
Sse9I AATT 1 cut(s) 106
SspMI CTAG 1 cut(s) 144
TasI AATT 1 cut(s) 106
TscAI CASTG 1 cut(s) 49
TspRI CASTG 1 cut(s) 49
XapI RAATTY 1 cut(s) 106
XspI CTAG 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.