Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006715.1

Orthogroup ID

OG0004862

Physical Location & Seq

Genomic Coordinates Forward (+)

7320 .. 8927

Gene Structure 1608 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006715.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1608 bp

atggaatactctgcacttcttgaaccttcttggccattccacaatttggtgaactccccttttgatcaatctgatcccatgaacatggatgatactcaaatgggtagctcagatttttcttctttgatcatcaactcagatgaattttctgacttatccgacacttgttcagacccttttgcctccttgttttctggtaatgatctgattcaggtctcatcacaggtggaggtattcccaatgaatttggaagaatttgaccctaatttgatgatagactgtttgtatggtagtttcttggaagggagtgaagggagtcttccttcacaagaaatctcctcacaattttctattgaaggtgattgtgtgtcaaattcattggtgacttctgaagtatcatcaatggactcgacatcaatccaaacatcactaactttgcctgcagaaatggtggaaatagataacgaatcaagtattcgtcatcttctcaaggctcatgcagaatccatggcaaatggacagaaagagctagaggaggtaattttcagatgcatcaaggacaaagtcagcccaattgggcagagtttggatcgtcttgcatttcacttgtgtcgagaagttgttgatgatcaacaaggcgatgttgattatctgaaacaacaatcctacaagaattttgagcctgcattcaagttgttctaccaaaactttccctacgggaagtttgctcactatgcggcaaactcagcaatcctagagtctattcccgaggatacagagatggttcacatagtagattttgatatgggagaaggggtgcagttgtcacagatgattgaagctttagcacaaagactcaaaacattgagagtgacagcaattaaatgggaagatgaagaaagtgattgtgttctacaaggtagatttgacgagagaaagaagcaacttcagaatcatgcaagatcttttggcttatacttgaaggtggaggaagttgcactagaggatctggtgggagagataaagaagacaaaaaagaggggtgtaaaagaattcttagccttcaactgtatggtctcgcttccacacatgcggaggaggagaagccgaagtcttgcattggaatttctgagactggctaaggatttgttggccaaatcagggaactacaggactgggaaaacaggcattgtgacctttggagatggggaggcttgtgggagacttgaaaatcagttggatttcagctctttctttgatgggaatctggtgcattaccaagccttatcagagtcaatggaatcaaattttccaagtcatctagcagaagcaagaatggtgatggaaagcattttcctagcaccatatgtatcgtctcaggcttggttccagaactggaccgaaatgagggaagactgccatgtacaaccatggtttgggctggagggtcgtagactgagcaaagagaacttgttggaagctgagggcattgttggagacgaaagctcctatggaattaggattggaggagagaatggaaatgagatggccttggaatggagagggaatcctttggtcagagtttcaacctgggaaaaccaaagctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

GRAS

Protein Analysis

535

Amino Acids

60.47

Weight (kDa)

4.62

Isoelectric Point (pI)

45.32

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004862)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g10940 FvH4_6g10950
malus_domestica	MD04G1163300.v1.1 MD04G1163400.v1.1 MD12G1176900.v1.1 MD12G1177000.v1.1 MD12G1177200.v1.1
prunus_persica	Prupe.6G282800_v2.0.a1
pyrus_communis	pycom04g14610 pycom12g16760
rosa_chinensis	RchiOBHm_Chr3g0462211 RchiOBHm_Chr3g0462231
rosa_laevigata	RLG00000024876 RLG00000024877
rosa_multiflora	Rmu_sc0006188.1_g000008 Rmu_sc0006715.1_g000002 Rmu_sc0007627.1_g000001 Rmu_sc0007627.1_g000002
rosa_roxburghii	Rroxscaffold_6G00417670 Rroxscaffold_6G00417680
rosa_rugosa	Rorug03G0055000 Rorug03G0055100
rosa_samantha	Rh3AG113800 Rh3BG116700 Rh3BG116800 Rh3CG119600 Rh3CG119700 Rh3DG118600 Rh3DG118700
rosa_wichuraiana	Rw3G009600 Rw3G009610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	2 cut(s)	46, 1436
AccI	GTMKAC	1 cut(s)	1453
AciI	CCGC	2 cut(s)	737, 1093
AclWI	GGATC	3 cut(s)	68, 597, 1014
AcoI	YGGCCR	2 cut(s)	32, 1152
AcsI	RAATTY	8 cut(s)	143, 244, 254, 373, 673, 1052, 1124, 1306
AcuI	CTGAAG	2 cut(s)	411, 932
AfaI	GTAC	1 cut(s)	1425
AfiI	CCNNNNNNNGG	5 cut(s)	46, 1161, 1407, 1436, 1557
AgsI	TTSAA	8 cut(s)	23, 356, 691, 839, 982, 1066, 1229, 1587
AjnI	CCWGG	1 cut(s)	1589
AluBI	AGCT	7 cut(s)	108, 529, 842, 1248, 1481, 1506, 1605
AluI	AGCT	7 cut(s)	108, 529, 842, 1248, 1481, 1506, 1605
Alw26I	GTCTC	6 cut(s)	220, 1081, 1126, 1216, 1380, 1491
AlwI	GGATC	3 cut(s)	68, 597, 1014
Ama87I	CYCGRG	1 cut(s)	767
AoxI	GGCC	3 cut(s)	32, 1152, 1548
ApoI	RAATTY	8 cut(s)	143, 244, 254, 373, 673, 1052, 1124, 1306
AspS9I	GGNCC	1 cut(s)	1398
AsuHPI	GGTGA	4 cut(s)	61, 371, 394, 1351
AvaI	CYCGRG	1 cut(s)	767
AvaII	GGWCC	1 cut(s)	1398
BalI	TGGCCA	2 cut(s)	34, 1154
BbsI	GAAGAC	3 cut(s)	311, 1034, 1419
BbvCI	CCTCAGC	1 cut(s)	1482
BccI	CCATC	5 cut(s)	775, 1199, 1253, 1336, 1540
BciT130I	CCWGG	1 cut(s)	1591
BciVI	GTATCC	1 cut(s)	766
BclI	TGATCA	3 cut(s)	64, 126, 628
BcoDI	GTCTC	6 cut(s)	220, 1081, 1126, 1216, 1380, 1491
BfaI	CTAG	6 cut(s)	530, 755, 1001, 1322, 1358, 1606
BfmI	CTRYAG	2 cut(s)	441, 1168
BfuI	GTATCC	1 cut(s)	766
BglII	AGATCT	1 cut(s)	962
BisI	GCNGC	1 cut(s)	738
BlsI	GCNGC	1 cut(s)	739
Bme1390I	CCNGG	1 cut(s)	1591
Bme18I	GGWCC	1 cut(s)	1398
BmeT110I	CYCGRG	1 cut(s)	767
BmgT120I	GGNCC	1 cut(s)	1398
BmiI	GGNNCC	1 cut(s)	1388
BmrFI	CCNGG	1 cut(s)	1591
BmrI	ACTGGG	1 cut(s)	1185
BmsI	GCATC	2 cut(s)	539, 561
BmuI	ACTGGG	1 cut(s)	1185
BpiI	GAAGAC	3 cut(s)	311, 1034, 1419
BpmI	CTGGAG	1 cut(s)	1463
Bpu10I	CCTNAGC	2 cut(s)	1140, 1482
BpuEI	CTTGAG	1 cut(s)	473
BsaBI	GATNNNNATC	1 cut(s)	1263
BsaI	GGTCTC	2 cut(s)	220, 1081
BsaJI	CCNNGG	5 cut(s)	507, 768, 1430, 1551, 1590
BsaXI	ACNNNNNCTCC	4 cut(s)	801, 831, 1490, 1520
Bsc4I	CCNNNNNNNGG	5 cut(s)	46, 1161, 1407, 1436, 1557
Bse1I	ACTGG	3 cut(s)	1140, 1180, 1400
Bse8I	GATNNNNATC	1 cut(s)	1263
BseBI	CCWGG	1 cut(s)	1591
BseDI	CCNNGG	5 cut(s)	507, 768, 1430, 1551, 1590
BseGI	GGATG	1 cut(s)	94
BseJI	GATNNNNATC	1 cut(s)	1263
BseLI	CCNNNNNNNGG	5 cut(s)	46, 1161, 1407, 1436, 1557
BseMII	CTCAG	7 cut(s)	123, 150, 759, 1121, 1391, 1448, 1473
BseNI	ACTGG	3 cut(s)	1140, 1180, 1400
BseRI	GAGGAG	5 cut(s)	328, 548, 1111, 1114, 1542
BsgI	GTGCAG	1 cut(s)	839
BshFI	GGCC	3 cut(s)	34, 1154, 1550
BsiHKCI	CYCGRG	1 cut(s)	767
BslI	CCNNNNNNNGG	5 cut(s)	46, 1161, 1407, 1436, 1557
BsmAI	GTCTC	6 cut(s)	220, 1081, 1126, 1216, 1380, 1491
BsmBI	CGTCTC	2 cut(s)	1380, 1491
BsmI	GAATGC	1 cut(s)	686
BsnI	GGCC	3 cut(s)	34, 1154, 1550
Bso31I	GGTCTC	2 cut(s)	220, 1081
BsoBI	CYCGRG	1 cut(s)	767
Bsp1407I	TGTACA	1 cut(s)	1423
Bsp143I	GATC	8 cut(s)	64, 73, 126, 202, 589, 628, 962, 1006
Bsp19I	CCATGG	2 cut(s)	507, 1430
BspACI	CCGC	2 cut(s)	737, 1093
BspANI	GGCC	3 cut(s)	34, 1154, 1550
BspCNI	CTCAG	7 cut(s)	122, 149, 758, 1122, 1390, 1449, 1474
BspLI	GGNNCC	1 cut(s)	1388
BspMAI	CTGCAG	1 cut(s)	445
BspPI	GGATC	3 cut(s)	68, 597, 1014
BspTNI	GGTCTC	2 cut(s)	220, 1081
BsrGI	TGTACA	1 cut(s)	1423
BsrI	ACTGG	3 cut(s)	1140, 1180, 1400
BssECI	CCNNGG	5 cut(s)	507, 768, 1430, 1551, 1590
BssMI	GATC	8 cut(s)	64, 73, 126, 202, 589, 628, 962, 1006
BssT1I	CCWWGG	3 cut(s)	507, 1430, 1551
Bst2UI	CCWGG	1 cut(s)	1591
Bst4CI	ACNGT	2 cut(s)	281, 1070
BstAUI	TGTACA	1 cut(s)	1423
BstC8I	GCNNGC	2 cut(s)	441, 684
BstDEI	CTNAG	9 cut(s)	109, 136, 745, 1057, 1130, 1140, 1377, 1457, 1482
BstDSI	CCRYGG	2 cut(s)	507, 1430
BstF5I	GGATG	1 cut(s)	94
BstKTI	GATC	8 cut(s)	67, 76, 129, 205, 592, 631, 965, 1009
BstMAI	GTCTC	6 cut(s)	220, 1081, 1126, 1216, 1380, 1491
BstMBI	GATC	8 cut(s)	64, 73, 126, 202, 589, 628, 962, 1006
BstMWI	GCNNNNNNNGC	2 cut(s)	734, 746
BstNI	CCWGG	1 cut(s)	1591
BstNSI	RCATGY	1 cut(s)	1093
BstSCI	CCNGG	1 cut(s)	1589
BstSFI	CTRYAG	2 cut(s)	441, 1168
BstV2I	GAAGAC	3 cut(s)	311, 1034, 1419
BstX2I	RGATCY	2 cut(s)	962, 1006
BstXI	CCANNNNNNTGG	1 cut(s)	85
BstYI	RGATCY	2 cut(s)	962, 1006
BsuI	GTATCC	1 cut(s)	766
BsuRI	GGCC	3 cut(s)	34, 1154, 1550
BtgI	CCRYGG	2 cut(s)	507, 1430
BtgZI	GCGATG	1 cut(s)	654
BtsCI	GGATG	1 cut(s)	94
Cac8I	GCNNGC	2 cut(s)	441, 684
Cfr13I	GGNCC	1 cut(s)	1398
Csp6I	GTAC	1 cut(s)	1424
CviAII	CATG	8 cut(s)	79, 85, 497, 508, 956, 1090, 1421, 1431
CviQI	GTAC	1 cut(s)	1424
DdeI	CTNAG	9 cut(s)	109, 136, 745, 1057, 1130, 1140, 1377, 1457, 1482
DpnI	GATC	8 cut(s)	66, 75, 128, 204, 591, 630, 964, 1008
DpnII	GATC	8 cut(s)	64, 73, 126, 202, 589, 628, 962, 1006
EaeI	YGGCCR	2 cut(s)	32, 1152
Eco130I	CCWWGG	3 cut(s)	507, 1430, 1551
Eco31I	GGTCTC	2 cut(s)	220, 1081
Eco47I	GGWCC	1 cut(s)	1398
Eco57I	CTGAAG	2 cut(s)	411, 932
Eco88I	CYCGRG	1 cut(s)	767
EcoRI	GAATTC	1 cut(s)	1052
EcoRII	CCWGG	1 cut(s)	1589
EcoT14I	CCWWGG	3 cut(s)	507, 1430, 1551
EcoT22I	ATGCAT	1 cut(s)	554
ErhI	CCWWGG	3 cut(s)	507, 1430, 1551
Esp3I	CGTCTC	2 cut(s)	1380, 1491
FaeI	CATG	8 cut(s)	82, 88, 500, 511, 959, 1093, 1424, 1434
FalI	AAGNNNNNCTT	2 cut(s)	303, 335
FatI	CATG	8 cut(s)	78, 84, 496, 507, 955, 1089, 1420, 1430
FauNDI	CATATG	1 cut(s)	1366
FbaI	TGATCA	3 cut(s)	64, 126, 628
FblI	GTMKAC	1 cut(s)	1453
Fnu4HI	GCNGC	1 cut(s)	738
FokI	GGATG	1 cut(s)	101
Fsp4HI	GCNGC	1 cut(s)	738
FspBI	CTAG	6 cut(s)	530, 755, 1001, 1322, 1358, 1606
GluI	GCNGC	1 cut(s)	738
GsuI	CTGGAG	1 cut(s)	1463
HaeIII	GGCC	3 cut(s)	34, 1154, 1550
Hin1II	CATG	8 cut(s)	82, 88, 500, 511, 959, 1093, 1424, 1434
HindIII	AAGCTT	1 cut(s)	840
HphI	GGTGA	4 cut(s)	61, 371, 394, 1351
Hpy166II	GTNNAC	3 cut(s)	52, 787, 1454
Hpy188III	TCNNGA	4 cut(s)	20, 614, 767, 1390
Hpy8I	GTNNAC	3 cut(s)	52, 787, 1454
HpyAV	CCTTC	8 cut(s)	36, 296, 305, 333, 350, 806, 976, 1072
HpyCH4III	ACNGT	2 cut(s)	281, 1070
HpyF10VI	GCNNNNNNNGC	2 cut(s)	734, 746
HpyF3I	CTNAG	9 cut(s)	109, 136, 745, 1057, 1130, 1140, 1377, 1457, 1482
Hsp92II	CATG	8 cut(s)	82, 88, 500, 511, 959, 1093, 1424, 1434
Ksp22I	TGATCA	3 cut(s)	64, 126, 628
Kzo9I	GATC	8 cut(s)	64, 73, 126, 202, 589, 628, 962, 1006
LmnI	GCTCC	1 cut(s)	1511
LweI	GCATC	2 cut(s)	539, 561
MaeI	CTAG	6 cut(s)	530, 755, 1001, 1322, 1358, 1606
MaeIII	GTNAC	4 cut(s)	382, 825, 871, 1192
MalI	GATC	8 cut(s)	66, 75, 128, 204, 591, 630, 964, 1008
MboI	GATC	8 cut(s)	64, 73, 126, 202, 589, 628, 962, 1006
MboII	GAAGA	8 cut(s)	111, 263, 311, 476, 902, 908, 1039, 1424
MfeI	CAATTG	1 cut(s)	573
MflI	RGATCY	2 cut(s)	962, 1006
MlsI	TGGCCA	2 cut(s)	34, 1154
MluNI	TGGCCA	2 cut(s)	34, 1154
MlyI	GAGTC	5 cut(s)	325, 401, 767, 849, 1301
MmeI	TCCRAC	4 cut(s)	183, 1218, 1455, 1474
Mox20I	TGGCCA	2 cut(s)	34, 1154
Mph1103I	ATGCAT	1 cut(s)	554
MscI	TGGCCA	2 cut(s)	34, 1154
MseI	TTAA	1 cut(s)	882
MslI	CAYNNNNRTG	1 cut(s)	83
Msp20I	TGGCCA	2 cut(s)	34, 1154
MspR9I	CCNGG	1 cut(s)	1591
MunI	CAATTG	1 cut(s)	573
Mva1269I	GAATGC	1 cut(s)	686
MvaI	CCWGG	1 cut(s)	1591
MwoI	GCNNNNNNNGC	2 cut(s)	734, 746
NcoI	CCATGG	2 cut(s)	507, 1430
NdeI	CATATG	1 cut(s)	1366
NdeII	GATC	8 cut(s)	64, 73, 126, 202, 589, 628, 962, 1006
NlaIII	CATG	8 cut(s)	82, 88, 500, 511, 959, 1093, 1424, 1434
NlaIV	GGNNCC	1 cut(s)	1388
NmuCI	GTSAC	4 cut(s)	382, 825, 871, 1192
NsiI	ATGCAT	1 cut(s)	554
NspI	RCATGY	1 cut(s)	1093
PctI	GAATGC	1 cut(s)	686
PfeI	GAWTC	7 cut(s)	208, 467, 503, 952, 1264, 1301, 1567
PflFI	GACNNNGTC	1 cut(s)	563
PflMI	CCANNNNNTGG	2 cut(s)	46, 1436
PkrI	GCNGC	1 cut(s)	739
PleI	GAGTC	5 cut(s)	324, 401, 766, 849, 1300
PpsI	GAGTC	5 cut(s)	324, 401, 766, 849, 1300
Psp6I	CCWGG	1 cut(s)	1589
PspGI	CCWGG	1 cut(s)	1589
PspN4I	GGNNCC	1 cut(s)	1388
PspPI	GGNCC	1 cut(s)	1398
PstI	CTGCAG	1 cut(s)	445
PsuI	RGATCY	2 cut(s)	962, 1006
PsyI	GACNNNGTC	1 cut(s)	563
RsaI	GTAC	1 cut(s)	1425
RsaNI	GTAC	1 cut(s)	1424
RseI	CAYNNNNRTG	1 cut(s)	83
SaqAI	TTAA	1 cut(s)	882
SatI	GCNGC	1 cut(s)	738
Sau3AI	GATC	8 cut(s)	64, 73, 126, 202, 589, 628, 962, 1006
Sau96I	GGNCC	1 cut(s)	1398
SchI	GAGTC	5 cut(s)	325, 401, 767, 849, 1301
ScrFI	CCNGG	1 cut(s)	1591
SfaNI	GCATC	2 cut(s)	539, 561
SfcI	CTRYAG	2 cut(s)	441, 1168
SinI	GGWCC	1 cut(s)	1398
SmiMI	CAYNNNNRTG	1 cut(s)	83
SmlI	CTYRAG	1 cut(s)	488
SmoI	CTYRAG	1 cut(s)	488
SsiI	CCGC	2 cut(s)	737, 1093
SspMI	CTAG	6 cut(s)	530, 755, 1001, 1322, 1358, 1606
StyD4I	CCNGG	1 cut(s)	1589
StyI	CCWWGG	3 cut(s)	507, 1430, 1551
TaaI	ACNGT	2 cut(s)	281, 1070
TaqI	TCGA	2 cut(s)	410, 613
TaqII	GACCGA	1 cut(s)	1415
TatI	WGTACW	1 cut(s)	1423
TauI	GCSGC	1 cut(s)	740
TfiI	GAWTC	7 cut(s)	208, 467, 503, 952, 1264, 1301, 1567
Tru1I	TTAA	1 cut(s)	882
Tru9I	TTAA	1 cut(s)	882
TseFI	GTSAC	4 cut(s)	382, 825, 871, 1192
Tsp45I	GTSAC	4 cut(s)	382, 825, 871, 1192
TspDTI	ATGAA	5 cut(s)	95, 156, 257, 366, 909
Tth111I	GACNNNGTC	1 cut(s)	563
Van91I	CCANNNNNTGG	2 cut(s)	46, 1436
VpaK11BI	GGWCC	1 cut(s)	1398
XapI	RAATTY	8 cut(s)	143, 244, 254, 373, 673, 1052, 1124, 1306
XceI	RCATGY	1 cut(s)	1093
XmiI	GTMKAC	1 cut(s)	1453
XspI	CTAG	6 cut(s)	530, 755, 1001, 1322, 1358, 1606
Zsp2I	ATGCAT	1 cut(s)	554

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.