Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007627.1

Orthogroup ID

OG0004862

Physical Location & Seq

Genomic Coordinates Forward (+)

52 .. 1257

Gene Structure 1206 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007627.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1206 bp

atggactcaacatcaatccaatcaccactaaatttgcctagagaagaggagggaatcgagaaccaattgagtattcgtcatctacttgaagcttttgctgaagccaaggaatatggccagaaagatctagaggaggttattctcagctgcatcagtgagaaagtcagcccaattggagagtctttcgaacgccttgcattcaacttgtgccaagaagttgttgatgaacatcaacaaggcggcgattatctcaaacaagaatccttgaagaattttgaggctgcatttaaggtgttcatccaaaacttcccctatgctaggtttgctcactatgtagcaaactcagcaatcctcgaggcgattccagcggaagctgaggcaattcacattgtggatttcgacatgagagaaggggtccagttgtctcaacttattgaggctttagcacaaagattcaaaacactaaaagtgacagcaatcaagtgggaagaggaagagagtgattgtgctcctccacacgggagatttgaggagacaaagaagcaactccagaaccatgctagatcctttggcttaaacttaaaggtggaagaagtagcaatgcaggacttggtgactgagataaagaaggcaaagaagaggggtggagggaaagaattcttagccttcaactgtatggtttcacttccacacatgaggaggagaagaagcagagggcatgtcatggagtatctgagactggctaaggagttagccaattctgggaactccaagactactaaaagtggtattataactttcggtgatggggatgcttgtgagagacttggaaatcactcgagtttcagctcattctttaatgagaatctagtgcattaccaagccttgttggagtcaatggagttgaatttcccaagtcatctggcagaagcaagaatagcgatggaatgcatcttcatagcaccttttgtctcttcacaggcttggttccaaaagtggacagaaatgaaggactgccatgttcaaccatggttcggacttgagggtcggagtttgagcaaagaaaatttgatggaagccaaggaaattgtgggagatgaaagatcctatggaatcaggattgaaggactcaatgggaatgaaatggtattggaatggagaggaactcctctggttagagtatcaacttgggaaaaccaaagctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

GRAS

Protein Analysis

401

Amino Acids

45.67

Weight (kDa)

5.4

Isoelectric Point (pI)

50.17

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004862)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g10940 FvH4_6g10950
malus_domestica	MD04G1163300.v1.1 MD04G1163400.v1.1 MD12G1176900.v1.1 MD12G1177000.v1.1 MD12G1177200.v1.1
prunus_persica	Prupe.6G282800_v2.0.a1
pyrus_communis	pycom04g14610 pycom12g16760
rosa_chinensis	RchiOBHm_Chr3g0462211 RchiOBHm_Chr3g0462231
rosa_laevigata	RLG00000024876 RLG00000024877
rosa_multiflora	Rmu_sc0006188.1_g000008 Rmu_sc0006715.1_g000002 Rmu_sc0007627.1_g000001 Rmu_sc0007627.1_g000002
rosa_roxburghii	Rroxscaffold_6G00417670 Rroxscaffold_6G00417680
rosa_rugosa	Rorug03G0055000 Rorug03G0055100
rosa_samantha	Rh3AG113800 Rh3BG116700 Rh3BG116800 Rh3CG119600 Rh3CG119700 Rh3DG118600 Rh3DG118700
rosa_wichuraiana	Rw3G009600 Rw3G009610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	794
AasI	GACNNNNNNGTC	1 cut(s)	1044
AbsI	CCTCGAGG	1 cut(s)	353
AciI	CCGC	2 cut(s)	240, 368
AclWI	GGATC	2 cut(s)	558, 1098
AcoI	YGGCCR	1 cut(s)	115
AcsI	RAATTY	5 cut(s)	31, 271, 656, 907, 1066
AcuI	CTGAAG	1 cut(s)	120
AdeI	CACNNNGTG	1 cut(s)	391
AfiI	CCNNNNNNNGG	4 cut(s)	318, 518, 762, 1034
AgsI	TTSAA	8 cut(s)	89, 202, 268, 457, 670, 907, 1025, 1124
AjuI	GAANNNNNNNTTGG	2 cut(s)	57, 89
AluBI	AGCT	5 cut(s)	92, 147, 374, 849, 1203
AluI	AGCT	5 cut(s)	92, 147, 374, 849, 1203
Alw21I	GWGCWC	1 cut(s)	511
Alw26I	GTCTC	5 cut(s)	429, 527, 730, 817, 976
AlwI	GGATC	2 cut(s)	558, 1098
Ama87I	CYCGRG	2 cut(s)	353, 838
AoxI	GGCC	1 cut(s)	115
ApeKI	GCWGC	2 cut(s)	147, 281
ApoI	RAATTY	5 cut(s)	31, 271, 656, 907, 1066
Asp700I	GAANNNNTTC	1 cut(s)	656
AspS9I	GGNCC	1 cut(s)	415
AsuHPI	GGTGA	3 cut(s)	15, 625, 815
AsuII	TTCGAA	1 cut(s)	186
AvaI	CYCGRG	2 cut(s)	353, 838
AvaII	GGWCC	1 cut(s)	415
BalI	TGGCCA	1 cut(s)	117
Bbv12I	GWGCWC	1 cut(s)	511
BbvCI	CCTCAGC	1 cut(s)	375
BbvI	GCAGC	2 cut(s)	134, 268
BccI	CCATC	3 cut(s)	800, 937, 1066
BcgI	CGANNNNNNTGC	2 cut(s)	176, 210
BcoDI	GTCTC	5 cut(s)	429, 527, 730, 817, 976
BfaI	CTAG	5 cut(s)	39, 128, 318, 561, 869
BglII	AGATCT	1 cut(s)	124
BisI	GCNGC	3 cut(s)	148, 241, 282
BlsI	GCNGC	3 cut(s)	149, 242, 283
Bme18I	GGWCC	1 cut(s)	415
BmeT110I	CYCGRG	2 cut(s)	353, 838
BmgT120I	GGNCC	1 cut(s)	415
BmiI	GGNNCC	2 cut(s)	416, 989
BmsI	GCATC	3 cut(s)	159, 802, 960
BplI	GAGNNNNNCTC	2 cut(s)	1150, 1182
BpmI	CTGGAG	1 cut(s)	533
Bpu10I	CCTNAGC	2 cut(s)	375, 744
Bpu14I	TTCGAA	1 cut(s)	186
BpuEI	CTTGAG	1 cut(s)	1061
BsaBI	GATNNNNATC	1 cut(s)	228
BsaJI	CCNNGG	3 cut(s)	105, 1028, 1080
Bsc4I	CCNNNNNNNGG	4 cut(s)	318, 518, 762, 1034
Bse1I	ACTGG	2 cut(s)	418, 744
Bse3DI	GCAATG	1 cut(s)	606
Bse8I	GATNNNNATC	1 cut(s)	228
BseDI	CCNNGG	3 cut(s)	105, 1028, 1080
BseGI	GGATG	2 cut(s)	297, 817
BseJI	GATNNNNATC	1 cut(s)	228
BseLI	CCNNNNNNNGG	4 cut(s)	318, 518, 762, 1034
BseMI	GCAATG	1 cut(s)	606
BseMII	CTCAG	5 cut(s)	157, 357, 366, 609, 725
BseNI	ACTGG	2 cut(s)	418, 744
BseRI	GAGGAG	7 cut(s)	62, 146, 501, 545, 712, 715, 1158
BseXI	GCAGC	2 cut(s)	134, 268
BshFI	GGCC	1 cut(s)	117
BsiHKAI	GWGCWC	1 cut(s)	511
BsiHKCI	CYCGRG	2 cut(s)	353, 838
BslI	CCNNNNNNNGG	4 cut(s)	318, 518, 762, 1034
BsmAI	GTCTC	5 cut(s)	429, 527, 730, 817, 976
BsmI	GAATGC	2 cut(s)	197, 953
BsnI	GGCC	1 cut(s)	117
BsoBI	CYCGRG	2 cut(s)	353, 838
Bsp119I	TTCGAA	1 cut(s)	186
Bsp1286I	GDGCHC	1 cut(s)	511
Bsp143I	GATC	3 cut(s)	124, 563, 1103
Bsp19I	CCATGG	1 cut(s)	1028
BspACI	CCGC	2 cut(s)	240, 368
BspANI	GGCC	1 cut(s)	117
BspCNI	CTCAG	5 cut(s)	156, 356, 367, 610, 726
BspLI	GGNNCC	2 cut(s)	416, 989
BspPI	GGATC	2 cut(s)	558, 1098
BspT104I	TTCGAA	1 cut(s)	186
BsrDI	GCAATG	1 cut(s)	606
BsrI	ACTGG	2 cut(s)	418, 744
BssECI	CCNNGG	3 cut(s)	105, 1028, 1080
BssMI	GATC	3 cut(s)	124, 563, 1103
BssT1I	CCWWGG	3 cut(s)	105, 1028, 1080
Bst4CI	ACNGT	1 cut(s)	674
Bst6I	CTCTTC	5 cut(s)	39, 483, 489, 632, 979
BstBI	TTCGAA	1 cut(s)	186
BstDEI	CTNAG	7 cut(s)	143, 343, 375, 618, 661, 734, 744
BstDSI	CCRYGG	1 cut(s)	1028
BstENI	CCTNNNNNAGG	1 cut(s)	316
BstF5I	GGATG	2 cut(s)	297, 817
BstKTI	GATC	3 cut(s)	127, 566, 1106
BstMAI	GTCTC	5 cut(s)	429, 527, 730, 817, 976
BstMBI	GATC	3 cut(s)	124, 563, 1103
BstMWI	GCNNNNNNNGC	4 cut(s)	323, 344, 365, 938
BstNSI	RCATGY	1 cut(s)	722
BstV1I	GCAGC	2 cut(s)	134, 268
BstX2I	RGATCY	3 cut(s)	124, 563, 1103
BstYI	RGATCY	3 cut(s)	124, 563, 1103
BsuRI	GGCC	1 cut(s)	117
BtgI	CCRYGG	1 cut(s)	1028
BtgZI	GCGATG	1 cut(s)	956
BtsCI	GGATG	2 cut(s)	297, 817
BtsIMutI	CAGTG	1 cut(s)	160
Cfr13I	GGNCC	1 cut(s)	415
CspCI	CAANNNNNGTGG	2 cut(s)	15, 50
CviAII	CATG	7 cut(s)	403, 557, 694, 719, 724, 1019, 1029
DdeI	CTNAG	7 cut(s)	143, 343, 375, 618, 661, 734, 744
DpnI	GATC	3 cut(s)	126, 565, 1105
DpnII	GATC	3 cut(s)	124, 563, 1103
DraIII	CACNNNGTG	1 cut(s)	391
DrdI	GACNNNNNNGTC	1 cut(s)	1044
DseDI	GACNNNNNNGTC	1 cut(s)	1044
EaeI	YGGCCR	1 cut(s)	115
Eam1104I	CTCTTC	5 cut(s)	39, 483, 489, 632, 979
EarI	CTCTTC	5 cut(s)	39, 483, 489, 632, 979
Eco130I	CCWWGG	3 cut(s)	105, 1028, 1080
Eco47I	GGWCC	1 cut(s)	415
Eco57I	CTGAAG	1 cut(s)	120
Eco88I	CYCGRG	2 cut(s)	353, 838
EcoNI	CCTNNNNNAGG	1 cut(s)	316
EcoRI	GAATTC	1 cut(s)	656
EcoT14I	CCWWGG	3 cut(s)	105, 1028, 1080
EcoT22I	ATGCAT	1 cut(s)	953
ErhI	CCWWGG	3 cut(s)	105, 1028, 1080
FaeI	CATG	7 cut(s)	406, 560, 697, 722, 727, 1022, 1032
FatI	CATG	7 cut(s)	402, 556, 693, 718, 723, 1018, 1028
Fnu4HI	GCNGC	3 cut(s)	148, 241, 282
FokI	GGATG	2 cut(s)	284, 824
Fsp4HI	GCNGC	3 cut(s)	148, 241, 282
FspBI	CTAG	5 cut(s)	39, 128, 318, 561, 869
GluI	GCNGC	3 cut(s)	148, 241, 282
GsuI	CTGGAG	1 cut(s)	533
HaeIII	GGCC	1 cut(s)	117
Hin1II	CATG	7 cut(s)	406, 560, 697, 722, 727, 1022, 1032
HindIII	AAGCTT	1 cut(s)	90
HphI	GGTGA	3 cut(s)	15, 625, 815
Hpy166II	GTNNAC	1 cut(s)	999
Hpy188I	TCNGA	3 cut(s)	735, 1037, 1050
Hpy188III	TCNNGA	4 cut(s)	58, 128, 550, 1117
Hpy8I	GTNNAC	1 cut(s)	999
HpyAV	CCTTC	5 cut(s)	404, 622, 676, 1003, 1118
HpyCH4III	ACNGT	1 cut(s)	674
HpyCH4V	TGCA	6 cut(s)	150, 197, 284, 604, 874, 951
HpyF10VI	GCNNNNNNNGC	4 cut(s)	323, 344, 365, 938
HpyF3I	CTNAG	7 cut(s)	143, 343, 375, 618, 661, 734, 744
Hsp92II	CATG	7 cut(s)	406, 560, 697, 722, 727, 1022, 1032
Kzo9I	GATC	3 cut(s)	124, 563, 1103
LmnI	GCTCC	1 cut(s)	514
Lsp1109I	GCAGC	2 cut(s)	134, 268
LweI	GCATC	3 cut(s)	159, 802, 960
MaeI	CTAG	5 cut(s)	39, 128, 318, 561, 869
MaeIII	GTNAC	2 cut(s)	469, 613
MalI	GATC	3 cut(s)	126, 565, 1105
MboI	GATC	3 cut(s)	124, 563, 1103
MboII	GAAGA	9 cut(s)	56, 280, 500, 506, 602, 649, 717, 946, 966
MfeI	CAATTG	2 cut(s)	65, 171
MflI	RGATCY	3 cut(s)	124, 563, 1103
MhlI	GDGCHC	1 cut(s)	511
MlsI	TGGCCA	1 cut(s)	117
MluNI	TGGCCA	1 cut(s)	117
MlyI	GAGTC	3 cut(s)	188, 902, 1122
MmeI	TCCRAC	2 cut(s)	870, 1028
Mox20I	TGGCCA	1 cut(s)	117
Mph1103I	ATGCAT	1 cut(s)	953
MroXI	GAANNNNTTC	1 cut(s)	656
MscI	TGGCCA	1 cut(s)	117
MseI	TTAA	4 cut(s)	288, 575, 581, 858
Msp20I	TGGCCA	1 cut(s)	117
MspA1I	CMGCKG	2 cut(s)	147, 368
MunI	CAATTG	2 cut(s)	65, 171
Mva1269I	GAATGC	2 cut(s)	197, 953
MwoI	GCNNNNNNNGC	4 cut(s)	323, 344, 365, 938
NcoI	CCATGG	1 cut(s)	1028
NdeII	GATC	3 cut(s)	124, 563, 1103
NlaIII	CATG	7 cut(s)	406, 560, 697, 722, 727, 1022, 1032
NlaIV	GGNNCC	2 cut(s)	416, 989
NmuCI	GTSAC	2 cut(s)	469, 613
NsiI	ATGCAT	1 cut(s)	953
NspI	RCATGY	1 cut(s)	722
NspV	TTCGAA	1 cut(s)	186
PaeR7I	CTCGAG	2 cut(s)	353, 838
PctI	GAATGC	2 cut(s)	197, 953
PdmI	GAANNNNTTC	1 cut(s)	656
PfeI	GAWTC	6 cut(s)	54, 260, 361, 453, 865, 1113
PkrI	GCNGC	3 cut(s)	149, 242, 283
PleI	GAGTC	3 cut(s)	187, 901, 1122
PpsI	GAGTC	3 cut(s)	187, 901, 1122
PsiI	TTATAA	1 cut(s)	794
PspN4I	GGNNCC	2 cut(s)	416, 989
PspPI	GGNCC	1 cut(s)	415
PspXI	VCTCGAGB	2 cut(s)	353, 838
PsuI	RGATCY	3 cut(s)	124, 563, 1103
PvuII	CAGCTG	1 cut(s)	147
SaqAI	TTAA	4 cut(s)	288, 575, 581, 858
SatI	GCNGC	3 cut(s)	148, 241, 282
Sau3AI	GATC	3 cut(s)	124, 563, 1103
Sau96I	GGNCC	1 cut(s)	415
SchI	GAGTC	3 cut(s)	188, 902, 1122
SduI	GDGCHC	1 cut(s)	511
SfaNI	GCATC	3 cut(s)	159, 802, 960
Sfr274I	CTCGAG	2 cut(s)	353, 838
SfuI	TTCGAA	1 cut(s)	186
SinI	GGWCC	1 cut(s)	415
SlaI	CTCGAG	2 cut(s)	353, 838
SmlI	CTYRAG	3 cut(s)	353, 838, 1040
SmoI	CTYRAG	3 cut(s)	353, 838, 1040
SsiI	CCGC	2 cut(s)	240, 368
SspMI	CTAG	5 cut(s)	39, 128, 318, 561, 869
StyI	CCWWGG	3 cut(s)	105, 1028, 1080
TaaI	ACNGT	1 cut(s)	674
TaqI	TCGA	5 cut(s)	57, 186, 354, 399, 839
TauI	GCSGC	1 cut(s)	243
TfiI	GAWTC	6 cut(s)	54, 260, 361, 453, 865, 1113
Tru1I	TTAA	4 cut(s)	288, 575, 581, 858
Tru9I	TTAA	4 cut(s)	288, 575, 581, 858
TscAI	CASTG	1 cut(s)	160
TseFI	GTSAC	2 cut(s)	469, 613
TseI	GCWGC	2 cut(s)	147, 281
Tsp45I	GTSAC	2 cut(s)	469, 613
TspDTI	ATGAA	6 cut(s)	240, 286, 946, 1022, 1113, 1155
TspRI	CASTG	1 cut(s)	160
VpaK11BI	GGWCC	1 cut(s)	415
XagI	CCTNNNNNAGG	1 cut(s)	316
XapI	RAATTY	5 cut(s)	31, 271, 656, 907, 1066
XbaI	TCTAGA	1 cut(s)	127
XceI	RCATGY	1 cut(s)	722
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1087
XhoI	CTCGAG	2 cut(s)	353, 838
XmnI	GAANNNNTTC	1 cut(s)	656
XspI	CTAG	5 cut(s)	39, 128, 318, 561, 869
Zsp2I	ATGCAT	1 cut(s)	953

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.