Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007114.1

Orthogroup ID

OG0003626

Physical Location & Seq

Genomic Coordinates Reverse (-)

73008 .. 76938

Gene Structure 3931 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007114.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1776 bp

atggaagagagaaagggatcagcaaaatcgaacaaggtggcagctgaaaatcaggagaaatgggtttatgattcttctgtggatcaaaaaggaaatgttcctctccgagcttcaactggtgtttggaaagcctctctctttattgttgcaattgagttcagtgagaggctgagttactttggaatagcaaccagtttaattatttacctgaccaaagtaattcatgaagacctcaagagtgcagcaaagagtgtcaactattggtctggtgttaccacaatgattccattctttggaggcttcatagctgatgcttatttgggtcgcttctcaactgttctggtctcatccatcatttaccttctgggtttgattcttctatccatgtcctggtttgtaccaaccctaaagccttgtgacacacatccatgtcttgaaccaagaaaaatccatgaagtggtgttcttcctagccatatacatgatctccataggaactggaggccataaaccctctttggagagctttggagctgaccaatttgatgatgatcacactgaagaaagaaagcaaaagatgtcctacttcaattggtggaactttgggctttgctgtggtcttttgcttggggtgactgtggttgtctacgtacaagaccatgtaagttggggtgtcgcagatatagttctcatggcagtcatgggtacctcgctggttatcttcattgttgggaggccgttttaccgctatcgaagacctacaggaagccccctgacaccaatgctgcaggttcttgtagcggccattgcgaagagaaagctgccatatccttctgatcctgctcaattgtatgaaatttcccagtcggagaaggtccgtgggaggcttttgtgccacaccaacaagctcaaatttcttgacaaggcagccatcataagcacagaaaattcagctgagaagcaaaatccttggactcttgcaacagtaacaaaggtcgaggagatgaaactagtcctcaacattatccccatttggctagccaccctaccatttggaatgtgtgtagcacaaacctctacgttcttcatcaaacaaggtgtctccatgaaccgaagcatcgccaacggtttcgagatcccccctgcctcaatctattctctcgcagccatcggaatgatcatatccgtcacgttctacgagaaaatcctagtccccgtcatgcgaagaacaactggaaacgagaggggaatcaacatcctccagagaatcggaattggaatgctcttcttaatcggcacaatggtagcagctgccttggtggagaagaaaagactagggattgttgagaaagaccctttaaagagttcacattccatgagtgtgttctggttagcaccccaatttgtgataattggatttggagatgggtttactcttgtaggtctacaggagtatttctacgaccaagttccggactccatgaggagcttgggaattgcgttttaccttggtgtaattggagctggaaattttctcagtagcctcttgatcacggccattgatcacatcacagagaaaagggggaagagttggtttggtaaggatttgaatagtagtcgtttggacaagttttactggctattggcttgtatggctgcagcaaatttgtgtgtttatgtgtttttggctcggcgttactcttacaagaatgtgcagaaggtagctgtggtcgactgctatgaagatgaagaggaaaagggcggttcattggcataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PTR2

Protein Analysis

591

Amino Acids

65.94

Weight (kDa)

8.88

Isoelectric Point (pI)

40.05

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003626)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G37900 AT2G37900 AT3G53960
fragaria_vesca	FvH4_6g12770 FvH4_7g23570 FvH4_7g23570 FvH4_7g23570 FvH4_7g23570 FvH4_7g23570 FvH4_7g23570
malus_domestica	MD01G1141500.v1.1 MD04G1138500.v1.1 MD07G1205700.v1.1 MD12G1153900.v1.1 MD12G1154200.v1.1
prunus_persica	Prupe.2G241800_v2.0.a1 Prupe.6G264100_v2.0.a1
pyrus_communis	pycom04g12670 pycom07g19250 pycom12g14650
rosa_chinensis	RchiOBHm_Chr1g0368741 RchiOBHm_Chr3g0464761
rosa_laevigata	RLG00000024674 RLG00000027192
rosa_multiflora	Rmu_sc0001791.1_g000017 Rmu_sc0007114.1_g000013
rosa_roxburghii	Rroxscaffold_4G00288310 Rroxscaffold_6G00415440
rosa_rugosa	Rorug01G0344800 Rorug03G0073800 Rorug03G0073900
rosa_samantha	Rh1AG351700 Rh1BG315400 Rh3DG137900
rosa_wichuraiana	Rw3G011160

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	778
Acc65I	GGTACC	1 cut(s)	704
AccB1I	GGYRCC	1 cut(s)	704
AccB7I	CCANNNNNTGG	3 cut(s)	293, 390, 457
AccI	GTMKAC	3 cut(s)	645, 1444, 1731
AccIII	TCCGGA	1 cut(s)	1471
AciI	CCGC	3 cut(s)	745, 800, 1761
AclWI	GGATC	4 cut(s)	25, 90, 830, 1129
AcoI	YGGCCR	2 cut(s)	801, 1554
AcsI	RAATTY	5 cut(s)	855, 911, 946, 1528, 1663
AcuI	CTGAAG	1 cut(s)	579
AfaI	GTAC	3 cut(s)	399, 651, 706
AfiI	CCNNNNNNNGG	4 cut(s)	293, 390, 457, 1471
AgsI	TTSAA	4 cut(s)	114, 437, 589, 1609
AhlI	ACTAGT	1 cut(s)	1009
AjnI	CCWGG	1 cut(s)	389
Alw26I	GTCTC	2 cut(s)	349, 1105
AlwI	GGATC	4 cut(s)	25, 90, 830, 1129
Aor13HI	TCCGGA	1 cut(s)	1471
AoxI	GGCC	4 cut(s)	502, 734, 801, 1554
ApoI	RAATTY	5 cut(s)	855, 911, 946, 1528, 1663
ArsI	GACNNNNNNTTYG	2 cut(s)	1083, 1115
Asp718I	GGTACC	1 cut(s)	704
AspS9I	GGNCC	1 cut(s)	874
AsuHPI	GGTGA	1 cut(s)	643
AsuNHI	GCTAGC	1 cut(s)	1036
AvaII	GGWCC	1 cut(s)	874
BanI	GGYRCC	1 cut(s)	704
BbsI	GAAGAC	2 cut(s)	234, 760
BccI	CCATC	4 cut(s)	359, 938, 1175, 1418
BceAI	ACGGC	2 cut(s)	721, 1569
BciT130I	CCWGG	1 cut(s)	391
BclI	TGATCA	4 cut(s)	550, 1176, 1548, 1561
BcoDI	GTCTC	2 cut(s)	349, 1105
BcuI	ACTAGT	1 cut(s)	1009
BfaI	CTAG	5 cut(s)	470, 1010, 1037, 1208, 1334
BfmI	CTRYAG	4 cut(s)	759, 785, 1445, 1656
BfuAI	ACCTGC	1 cut(s)	778
Bme1390I	CCNGG	1 cut(s)	391
Bme18I	GGWCC	1 cut(s)	874
BmgT120I	GGNCC	1 cut(s)	874
BmiI	GGNNCC	1 cut(s)	706
BmrFI	CCNGG	1 cut(s)	391
BmrI	ACTGGG	1 cut(s)	856
BmsI	GCATC	2 cut(s)	301, 1125
BmtI	GCTAGC	1 cut(s)	1040
BmuI	ACTGGG	1 cut(s)	856
BpiI	GAAGAC	2 cut(s)	234, 760
BpmI	CTGGAG	2 cut(s)	519, 1244
BpuEI	CTTGAG	1 cut(s)	218
BsaAI	YACGTR	1 cut(s)	649
BsaBI	GATNNNNATC	1 cut(s)	549
BsaI	GGTCTC	1 cut(s)	349
BsaJI	CCNNGG	4 cut(s)	877, 968, 1314, 1507
BsaWI	WCCGGW	1 cut(s)	1471
BsaXI	ACNNNNNCTCC	2 cut(s)	470, 500
Bsc4I	CCNNNNNNNGG	4 cut(s)	293, 390, 457, 1471
Bse1I	ACTGG	6 cut(s)	121, 192, 502, 862, 1237, 1640
Bse3DI	GCAATG	1 cut(s)	804
Bse8I	GATNNNNATC	1 cut(s)	549
BseAI	TCCGGA	1 cut(s)	1471
BseBI	CCWGG	1 cut(s)	391
BseDI	CCNNGG	4 cut(s)	877, 968, 1314, 1507
BseGI	GGATG	3 cut(s)	347, 424, 1254
BseJI	GATNNNNATC	1 cut(s)	549
BseLI	CCNNNNNNNGG	4 cut(s)	293, 390, 457, 1471
BseMI	GCAATG	1 cut(s)	804
BseMII	CTCAG	3 cut(s)	161, 945, 1549
BseNI	ACTGG	6 cut(s)	121, 192, 502, 862, 1237, 1640
BseRI	GAGGAG	2 cut(s)	1013, 1498
BsgI	GTGCAG	2 cut(s)	261, 1733
BshFI	GGCC	4 cut(s)	504, 736, 803, 1556
BshNI	GGYRCC	1 cut(s)	704
BsiSI	CCGG	1 cut(s)	1472
BslFI	GGGAC	1 cut(s)	1196
BslI	CCNNNNNNNGG	4 cut(s)	293, 390, 457, 1471
BsmAI	GTCTC	2 cut(s)	349, 1105
BsmFI	GGGAC	1 cut(s)	1196
BsmI	GAATGC	1 cut(s)	1284
BsnI	GGCC	4 cut(s)	504, 736, 803, 1556
Bso31I	GGTCTC	1 cut(s)	349
Bsp13I	TCCGGA	1 cut(s)	1471
Bsp143I	GATC	9 cut(s)	17, 82, 483, 550, 835, 1134, 1176, 1548, 1561
BspACI	CCGC	3 cut(s)	745, 800, 1761
BspANI	GGCC	4 cut(s)	504, 736, 803, 1556
BspCNI	CTCAG	3 cut(s)	162, 946, 1548
BspEI	TCCGGA	1 cut(s)	1471
BspHI	TCATGA	1 cut(s)	223
BspLI	GGNNCC	1 cut(s)	706
BspMAI	CTGCAG	2 cut(s)	789, 1660
BspMI	ACCTGC	1 cut(s)	778
BspOI	GCTAGC	1 cut(s)	1040
BspPI	GGATC	4 cut(s)	25, 90, 830, 1129
BspQI	GCTCTTC	1 cut(s)	1289
BspT107I	GGYRCC	1 cut(s)	704
BspTNI	GGTCTC	1 cut(s)	349
BsrDI	GCAATG	1 cut(s)	804
BsrI	ACTGG	6 cut(s)	121, 192, 502, 862, 1237, 1640
BssECI	CCNNGG	4 cut(s)	877, 968, 1314, 1507
BssMI	GATC	9 cut(s)	17, 82, 483, 550, 835, 1134, 1176, 1548, 1561
BssT1I	CCWWGG	3 cut(s)	968, 1314, 1507
Bst2UI	CCWGG	1 cut(s)	391
Bst4CI	ACNGT	4 cut(s)	337, 637, 985, 1127
Bst6I	CTCTTC	4 cut(s)	806, 1289, 1580, 1743
BstBAI	YACGTR	1 cut(s)	649
BstC8I	GCNNGC	1 cut(s)	1038
BstDEI	CTNAG	3 cut(s)	170, 954, 1535
BstDSI	CCRYGG	1 cut(s)	877
BstF5I	GGATG	3 cut(s)	347, 424, 1254
BstKTI	GATC	9 cut(s)	20, 85, 486, 553, 838, 1137, 1179, 1551, 1564
BstMAI	GTCTC	2 cut(s)	349, 1105
BstMBI	GATC	9 cut(s)	17, 82, 483, 550, 835, 1134, 1176, 1548, 1561
BstMWI	GCNNNNNNNGC	2 cut(s)	806, 1652
BstNI	CCWGG	1 cut(s)	391
BstSCI	CCNGG	1 cut(s)	389
BstSFI	CTRYAG	4 cut(s)	759, 785, 1445, 1656
BstSNI	TACGTA	1 cut(s)	649
BstV2I	GAAGAC	2 cut(s)	234, 760
BstX2I	RGATCY	1 cut(s)	1134
BstYI	RGATCY	1 cut(s)	1134
BsuRI	GGCC	4 cut(s)	504, 736, 803, 1556
BtgI	CCRYGG	1 cut(s)	877
BtgZI	GCGATG	1 cut(s)	1102
BtsCI	GGATG	3 cut(s)	347, 424, 1254
BtsIMutI	CAGTG	2 cut(s)	166, 555
BveI	ACCTGC	1 cut(s)	778
Cac8I	GCNNGC	1 cut(s)	1038
CciI	TCATGA	1 cut(s)	223
Cfr13I	GGNCC	1 cut(s)	874
Csp6I	GTAC	3 cut(s)	398, 650, 705
CviQI	GTAC	3 cut(s)	398, 650, 705
DdeI	CTNAG	3 cut(s)	170, 954, 1535
DpnI	GATC	9 cut(s)	19, 84, 485, 552, 837, 1136, 1178, 1550, 1563
DpnII	GATC	9 cut(s)	17, 82, 483, 550, 835, 1134, 1176, 1548, 1561
DraI	TTTAAA	1 cut(s)	1359
EaeI	YGGCCR	2 cut(s)	801, 1554
Eam1104I	CTCTTC	4 cut(s)	806, 1289, 1580, 1743
EarI	CTCTTC	4 cut(s)	806, 1289, 1580, 1743
Eco105I	TACGTA	1 cut(s)	649
Eco130I	CCWWGG	3 cut(s)	968, 1314, 1507
Eco31I	GGTCTC	1 cut(s)	349
Eco47I	GGWCC	1 cut(s)	874
Eco57I	CTGAAG	1 cut(s)	579
EcoRII	CCWGG	1 cut(s)	389
EcoT14I	CCWWGG	3 cut(s)	968, 1314, 1507
ErhI	CCWWGG	3 cut(s)	968, 1314, 1507
FaqI	GGGAC	1 cut(s)	1196
FbaI	TGATCA	4 cut(s)	550, 1176, 1548, 1561
FblI	GTMKAC	3 cut(s)	645, 1444, 1731
FokI	GGATG	3 cut(s)	334, 411, 1241
FspBI	CTAG	5 cut(s)	470, 1010, 1037, 1208, 1334
GsuI	CTGGAG	2 cut(s)	519, 1244
HaeIII	GGCC	4 cut(s)	504, 736, 803, 1556
HapII	CCGG	1 cut(s)	1472
HincII	GTYRAC	2 cut(s)	256, 1732
HindII	GTYRAC	2 cut(s)	256, 1732
HinfI	GANTC	7 cut(s)	71, 283, 373, 973, 1248, 1266, 1475
HpaII	CCGG	1 cut(s)	1472
HphI	GGTGA	1 cut(s)	643
Hpy166II	GTNNAC	6 cut(s)	256, 646, 1367, 1431, 1445, 1732
Hpy188I	TCNGA	5 cut(s)	107, 835, 868, 1172, 1271
Hpy188III	TCNNGA	9 cut(s)	53, 224, 235, 434, 917, 1132, 1261, 1472, 1546
Hpy8I	GTNNAC	6 cut(s)	256, 646, 1367, 1431, 1445, 1732
HpyAV	CCTTC	4 cut(s)	371, 840, 865, 1711
HpyCH4III	ACNGT	4 cut(s)	337, 637, 985, 1127
HpyCH4IV	ACGT	3 cut(s)	648, 1079, 1190
HpyCH4V	TGCA	6 cut(s)	149, 242, 787, 980, 1658, 1714
HpyF10VI	GCNNNNNNNGC	2 cut(s)	806, 1652
HpyF3I	CTNAG	3 cut(s)	170, 954, 1535
HpySE526I	ACGT	3 cut(s)	648, 1079, 1190
Kpn2I	TCCGGA	1 cut(s)	1471
KpnI	GGTACC	1 cut(s)	708
Ksp22I	TGATCA	4 cut(s)	550, 1176, 1548, 1561
Kzo9I	GATC	9 cut(s)	17, 82, 483, 550, 835, 1134, 1176, 1548, 1561
LguI	GCTCTTC	1 cut(s)	1289
LmnI	GCTCC	3 cut(s)	530, 1485, 1520
LweI	GCATC	2 cut(s)	301, 1125
MaeI	CTAG	5 cut(s)	470, 1010, 1037, 1208, 1334
MaeII	ACGT	3 cut(s)	648, 1079, 1190
MaeIII	GTNAC	7 cut(s)	173, 271, 416, 631, 985, 1186, 1694
MalI	GATC	9 cut(s)	19, 84, 485, 552, 837, 1136, 1178, 1550, 1563
MboI	GATC	9 cut(s)	17, 82, 483, 550, 835, 1134, 1176, 1548, 1561
MfeI	CAATTG	3 cut(s)	150, 589, 845
MflI	RGATCY	1 cut(s)	1134
MlyI	GAGTC	2 cut(s)	967, 1469
MmeI	TCCRAC	1 cut(s)	846
MroI	TCCGGA	1 cut(s)	1471
MseI	TTAA	3 cut(s)	197, 1289, 1358
MslI	CAYNNNNRTG	4 cut(s)	427, 479, 1172, 1379
MspA1I	CMGCKG	3 cut(s)	44, 953, 1310
MspI	CCGG	1 cut(s)	1472
MspR9I	CCNGG	1 cut(s)	391
MunI	CAATTG	3 cut(s)	150, 589, 845
Mva1269I	GAATGC	1 cut(s)	1284
MvaI	CCWGG	1 cut(s)	391
MwoI	GCNNNNNNNGC	2 cut(s)	806, 1652
NdeII	GATC	9 cut(s)	17, 82, 483, 550, 835, 1134, 1176, 1548, 1561
NheI	GCTAGC	1 cut(s)	1036
NlaIV	GGNNCC	1 cut(s)	706
NmeAIII	GCCGAG	1 cut(s)	1669
NmuCI	GTSAC	3 cut(s)	416, 631, 1186
PagI	TCATGA	1 cut(s)	223
PciSI	GCTCTTC	1 cut(s)	1289
PctI	GAATGC	1 cut(s)	1284
PfeI	GAWTC	5 cut(s)	71, 283, 373, 1248, 1266
PflMI	CCANNNNNTGG	3 cut(s)	293, 390, 457
PleI	GAGTC	2 cut(s)	967, 1469
PpsI	GAGTC	2 cut(s)	967, 1469
Ppu21I	YACGTR	1 cut(s)	649
Psp6I	CCWGG	1 cut(s)	389
PspGI	CCWGG	1 cut(s)	389
PspN4I	GGNNCC	1 cut(s)	706
PspPI	GGNCC	1 cut(s)	874
PstI	CTGCAG	2 cut(s)	789, 1660
PsuI	RGATCY	1 cut(s)	1134
PvuII	CAGCTG	3 cut(s)	44, 953, 1310
RsaI	GTAC	3 cut(s)	399, 651, 706
RsaNI	GTAC	3 cut(s)	398, 650, 705
RseI	CAYNNNNRTG	4 cut(s)	427, 479, 1172, 1379
SalI	GTCGAC	1 cut(s)	1730
SapI	GCTCTTC	1 cut(s)	1289
SaqAI	TTAA	3 cut(s)	197, 1289, 1358
Sau3AI	GATC	9 cut(s)	17, 82, 483, 550, 835, 1134, 1176, 1548, 1561
Sau96I	GGNCC	1 cut(s)	874
SchI	GAGTC	2 cut(s)	967, 1469
ScrFI	CCNGG	1 cut(s)	391
SfaNI	GCATC	2 cut(s)	301, 1125
SfcI	CTRYAG	4 cut(s)	759, 785, 1445, 1656
SinI	GGWCC	1 cut(s)	874
SmiMI	CAYNNNNRTG	4 cut(s)	427, 479, 1172, 1379
SmlI	CTYRAG	1 cut(s)	233
SmoI	CTYRAG	1 cut(s)	233
SnaBI	TACGTA	1 cut(s)	649
SpeI	ACTAGT	1 cut(s)	1009
SsiI	CCGC	3 cut(s)	745, 800, 1761
SspMI	CTAG	5 cut(s)	470, 1010, 1037, 1208, 1334
StyD4I	CCNGG	1 cut(s)	389
StyI	CCWWGG	3 cut(s)	968, 1314, 1507
TaaI	ACNGT	4 cut(s)	337, 637, 985, 1127
TaiI	ACGT	3 cut(s)	651, 1082, 1193
TaqI	TCGA	5 cut(s)	29, 751, 996, 1131, 1731
TauI	GCSGC	1 cut(s)	803
TfiI	GAWTC	5 cut(s)	71, 283, 373, 1248, 1266
Tru1I	TTAA	3 cut(s)	197, 1289, 1358
Tru9I	TTAA	3 cut(s)	197, 1289, 1358
TscAI	CASTG	2 cut(s)	166, 562
TseFI	GTSAC	3 cut(s)	416, 631, 1186
Tsp45I	GTSAC	3 cut(s)	416, 631, 1186
TspGWI	ACGGA	2 cut(s)	866, 1174
TspRI	CASTG	2 cut(s)	166, 562
Van91I	CCANNNNNTGG	3 cut(s)	293, 390, 457
VpaK11BI	GGWCC	1 cut(s)	874
XapI	RAATTY	5 cut(s)	855, 911, 946, 1528, 1663
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1486
XmiI	GTMKAC	3 cut(s)	645, 1444, 1731
XspI	CTAG	5 cut(s)	470, 1010, 1037, 1208, 1334

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.