Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007333.1

Orthogroup ID

OG0004495

Physical Location & Seq

Genomic Coordinates Reverse (-)

54976 .. 57173

Gene Structure 2198 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007333.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 621 bp

atgcttgaaggagggggaaaaacgccaatactcaatcctcttgaacttgaggaagttggatacaaaattgtggtttatccactttccttgattggggacgcactagctgctatcagaggaggtcgtatccctccacctggaagcatgccatcttttgaagaggttaaggaggtcctaggtttcaacagttattatgaagaagaaaagcggtattatagtaacagcagtcagctgtcttctgaaagattggccagtagtgtatacagtcttcaagggacatcaaaaaatgcagaaccaaaatatcagagtcctcaagatcccattgttgaagttataacacctgaagtgtacaataactatggagcagatggtttcaaggattcattttccgggatctggtctcggaaattgagaatcaaaataactggaagagatggatttgagaaacttgaagttagaattcctgctggattctcggacggaatcaccaatatagttccagctcttaggggtgtaaacatcaaagaattgttgaatgaggcagctgatgaaatgggagggaagcagctgttagattttaatgacacaatgggtgatagaattcaagtttttctagagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PEP_mutase

Protein Analysis

206

Amino Acids

22.76

Weight (kDa)

4.81

Isoelectric Point (pI)

38.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004495)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G43180 AT2G43180 AT2G43180 AT2G43180
fragaria_vesca	FvH4_4g11620 FvH4_4g11620
malus_domestica	MD04G1031000.v1.1
prunus_persica	Prupe.1G182700_v2.0.a1 Prupe.1G182700_v2.0.a1 Prupe.1G182700_v2.0.a1
pyrus_communis	pycom04g02620
rosa_chinensis	RchiOBHm_Chr4g0408741 RchiOBHm_Chr4g0408751
rosa_laevigata	RLG00000008633 RLG00000008634
rosa_multiflora	Rmu_sc0001258.1_g000006 Rmu_sc0005878.1_g000017 Rmu_sc0007333.1_g000009
rosa_roxburghii	Rroxscaffold_5G00353090
rosa_rugosa	Rorug04G0087300
rosa_samantha	Rh1DG149900 Rh4AG151500 Rh4AG151600 Rh4BG148700 Rh4BG148800 Rh4CG159600 Rh4CG159800 Rh4DG144700 Rh4DG144800
rosa_wichuraiana	Rw0G015170 Rw4G012420 Rw4G012440

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	335
AccI	GTMKAC	1 cut(s)	261
AciI	CCGC	1 cut(s)	208
AclWI	GGATC	2 cut(s)	311, 401
AcoI	YGGCCR	1 cut(s)	249
AcsI	RAATTY	2 cut(s)	459, 600
AcuI	CTGAAG	1 cut(s)	363
AfaI	GTAC	1 cut(s)	350
AfiI	CCNNNNNNNGG	3 cut(s)	93, 137, 396
AjnI	CCWGG	1 cut(s)	136
AluBI	AGCT	5 cut(s)	107, 232, 503, 545, 568
AluI	AGCT	5 cut(s)	107, 232, 503, 545, 568
Alw26I	GTCTC	1 cut(s)	405
AlwI	GGATC	2 cut(s)	311, 401
AoxI	GGCC	1 cut(s)	249
ApeKI	GCWGC	3 cut(s)	107, 542, 565
ApoI	RAATTY	2 cut(s)	459, 600
AspA2I	CCTAGG	1 cut(s)	175
AspS9I	GGNCC	1 cut(s)	172
AsuC2I	CCSGG	1 cut(s)	391
AsuHPI	GGTGA	2 cut(s)	478, 605
AvaII	GGWCC	1 cut(s)	172
AvrII	CCTAGG	1 cut(s)	175
BalI	TGGCCA	1 cut(s)	251
BarI	GAAGNNNNNNTAC	2 cut(s)	252, 284
BbsI	GAAGAC	2 cut(s)	228, 260
BbvI	GCAGC	3 cut(s)	94, 554, 577
BccI	CCATC	3 cut(s)	157, 362, 428
BciT130I	CCWGG	1 cut(s)	138
BciVI	GTATCC	2 cut(s)	53, 137
BcnI	CCSGG	1 cut(s)	391
BcoDI	GTCTC	1 cut(s)	405
BfaI	CTAG	3 cut(s)	104, 176, 614
BfuI	GTATCC	2 cut(s)	53, 137
BisI	GCNGC	3 cut(s)	108, 543, 566
BlnI	CCTAGG	1 cut(s)	175
BlsI	GCNGC	3 cut(s)	109, 544, 567
Bme1390I	CCNGG	2 cut(s)	138, 391
Bme18I	GGWCC	1 cut(s)	172
BmgT120I	GGNCC	1 cut(s)	172
BmrFI	CCNGG	2 cut(s)	138, 391
BpiI	GAAGAC	2 cut(s)	228, 260
BpuEI	CTTGAG	2 cut(s)	68, 297
BpuMI	CCSGG	1 cut(s)	391
BsaI	GGTCTC	1 cut(s)	405
BsaJI	CCNNGG	1 cut(s)	175
Bsc4I	CCNNNNNNNGG	3 cut(s)	93, 137, 396
Bse1I	ACTGG	2 cut(s)	252, 430
BseBI	CCWGG	1 cut(s)	138
BseDI	CCNNGG	1 cut(s)	175
BseLI	CCNNNNNNNGG	3 cut(s)	93, 137, 396
BseNI	ACTGG	2 cut(s)	252, 430
BseRI	GAGGAG	1 cut(s)	132
BseXI	GCAGC	3 cut(s)	94, 554, 577
BshFI	GGCC	1 cut(s)	251
BsiSI	CCGG	1 cut(s)	390
BslFI	GGGAC	2 cut(s)	110, 289
BslI	CCNNNNNNNGG	3 cut(s)	93, 137, 396
BsmAI	GTCTC	1 cut(s)	405
BsmFI	GGGAC	2 cut(s)	110, 289
BsnI	GGCC	1 cut(s)	251
Bso31I	GGTCTC	1 cut(s)	405
Bsp1407I	TGTACA	1 cut(s)	348
Bsp143I	GATC	2 cut(s)	316, 393
BspACI	CCGC	1 cut(s)	208
BspANI	GGCC	1 cut(s)	251
BspPI	GGATC	2 cut(s)	311, 401
BspTNI	GGTCTC	1 cut(s)	405
BsrGI	TGTACA	1 cut(s)	348
BsrI	ACTGG	2 cut(s)	252, 430
BssECI	CCNNGG	1 cut(s)	175
BssMI	GATC	2 cut(s)	316, 393
BssNAI	GTATAC	1 cut(s)	262
BssT1I	CCWWGG	1 cut(s)	175
Bst1107I	GTATAC	1 cut(s)	262
Bst2UI	CCWGG	1 cut(s)	138
Bst4CI	ACNGT	2 cut(s)	188, 266
Bst6I	CTCTTC	2 cut(s)	153, 424
BstAPI	GCANNNNNTGC	1 cut(s)	107
BstAUI	TGTACA	1 cut(s)	348
BstC8I	GCNNGC	1 cut(s)	146
BstDEI	CTNAG	1 cut(s)	506
BstKTI	GATC	2 cut(s)	319, 396
BstMAI	GTCTC	1 cut(s)	405
BstMBI	GATC	2 cut(s)	316, 393
BstMWI	GCNNNNNNNGC	1 cut(s)	107
BstNI	CCWGG	1 cut(s)	138
BstNSI	RCATGY	1 cut(s)	148
BstSCI	CCNGG	2 cut(s)	136, 389
BstV1I	GCAGC	3 cut(s)	94, 554, 577
BstV2I	GAAGAC	2 cut(s)	228, 260
BstX2I	RGATCY	2 cut(s)	316, 393
BstYI	RGATCY	2 cut(s)	316, 393
BstZ17I	GTATAC	1 cut(s)	262
BsuI	GTATCC	2 cut(s)	53, 137
BsuRI	GGCC	1 cut(s)	251
Cac8I	GCNNGC	1 cut(s)	146
Cfr13I	GGNCC	1 cut(s)	172
CseI	GACGC	1 cut(s)	107
Csp6I	GTAC	1 cut(s)	349
CspCI	CAANNNNNGTGG	2 cut(s)	69, 104
CviAII	CATG	1 cut(s)	145
CviJI	RGCY	6 cut(s)	107, 232, 251, 503, 545, 568
CviKI_1	RGCY	6 cut(s)	107, 232, 251, 503, 545, 568
CviQI	GTAC	1 cut(s)	349
DdeI	CTNAG	1 cut(s)	506
DpnI	GATC	2 cut(s)	318, 395
DpnII	GATC	2 cut(s)	316, 393
EaeI	YGGCCR	1 cut(s)	249
Eam1104I	CTCTTC	2 cut(s)	153, 424
EarI	CTCTTC	2 cut(s)	153, 424
Eco130I	CCWWGG	1 cut(s)	175
Eco31I	GGTCTC	1 cut(s)	405
Eco47I	GGWCC	1 cut(s)	172
Eco57I	CTGAAG	1 cut(s)	363
EcoO109I	RGGNCCY	1 cut(s)	172
EcoRI	GAATTC	2 cut(s)	459, 600
EcoRII	CCWGG	1 cut(s)	136
EcoT14I	CCWWGG	1 cut(s)	175
ErhI	CCWWGG	1 cut(s)	175
FaeI	CATG	1 cut(s)	148
FaiI	YATR	7 cut(s)	146, 195, 216, 262, 335, 360, 494
FaqI	GGGAC	2 cut(s)	110, 289
FatI	CATG	1 cut(s)	144
FblI	GTMKAC	1 cut(s)	261
Fnu4HI	GCNGC	3 cut(s)	108, 543, 566
Fsp4HI	GCNGC	3 cut(s)	108, 543, 566
FspBI	CTAG	3 cut(s)	104, 176, 614
GluI	GCNGC	3 cut(s)	108, 543, 566
HaeIII	GGCC	1 cut(s)	251
HapII	CCGG	1 cut(s)	390
HgaI	GACGC	1 cut(s)	107
Hin1II	CATG	1 cut(s)	148
HinfI	GANTC	5 cut(s)	307, 380, 414, 471, 483
HpaII	CCGG	1 cut(s)	390
HphI	GGTGA	2 cut(s)	478, 605
Hpy166II	GTNNAC	3 cut(s)	262, 349, 517
Hpy188I	TCNGA	5 cut(s)	116, 241, 306, 405, 478
Hpy188III	TCNNGA	3 cut(s)	41, 314, 614
Hpy8I	GTNNAC	3 cut(s)	262, 349, 517
HpyCH4III	ACNGT	2 cut(s)	188, 266
HpyCH4V	TGCA	1 cut(s)	290
HpyF10VI	GCNNNNNNNGC	1 cut(s)	107
HpyF3I	CTNAG	1 cut(s)	506
Hsp92II	CATG	1 cut(s)	148
Kzo9I	GATC	2 cut(s)	316, 393
LmnI	GCTCC	1 cut(s)	362
Lsp1109I	GCAGC	3 cut(s)	94, 554, 577
MaeI	CTAG	3 cut(s)	104, 176, 614
MaeIII	GTNAC	1 cut(s)	218
MalI	GATC	2 cut(s)	318, 395
MboI	GATC	2 cut(s)	316, 393
MboII	GAAGA	6 cut(s)	170, 209, 212, 228, 260, 441
MflI	RGATCY	2 cut(s)	316, 393
MlsI	TGGCCA	1 cut(s)	251
MluCI	AATT	5 cut(s)	66, 407, 459, 527, 600
MluNI	TGGCCA	1 cut(s)	251
MlyI	GAGTC	1 cut(s)	316
MmeI	TCCRAC	1 cut(s)	37
Mox20I	TGGCCA	1 cut(s)	251
MscI	TGGCCA	1 cut(s)	251
MseI	TTAA	2 cut(s)	165, 579
Msp20I	TGGCCA	1 cut(s)	251
MspA1I	CMGCKG	3 cut(s)	232, 545, 568
MspI	CCGG	1 cut(s)	390
MspR9I	CCNGG	2 cut(s)	138, 391
MvaI	CCWGG	1 cut(s)	138
MwoI	GCNNNNNNNGC	1 cut(s)	107
NciI	CCSGG	1 cut(s)	391
NdeII	GATC	2 cut(s)	316, 393
NlaIII	CATG	1 cut(s)	148
NspI	RCATGY	1 cut(s)	148
PaeI	GCATGC	1 cut(s)	148
PfeI	GAWTC	4 cut(s)	380, 414, 471, 483
PfoI	TCCNGGA	1 cut(s)	389
PkrI	GCNGC	3 cut(s)	109, 544, 567
PleI	GAGTC	1 cut(s)	315
PpsI	GAGTC	1 cut(s)	315
PpuMI	RGGWCCY	1 cut(s)	172
PsiI	TTATAA	1 cut(s)	335
Psp5II	RGGWCCY	1 cut(s)	172
Psp6I	CCWGG	1 cut(s)	136
PspGI	CCWGG	1 cut(s)	136
PspPI	GGNCC	1 cut(s)	172
PspPPI	RGGWCCY	1 cut(s)	172
PsuI	RGATCY	2 cut(s)	316, 393
PvuII	CAGCTG	3 cut(s)	232, 545, 568
RsaI	GTAC	1 cut(s)	350
RsaNI	GTAC	1 cut(s)	349
SaqAI	TTAA	2 cut(s)	165, 579
SatI	GCNGC	3 cut(s)	108, 543, 566
Sau3AI	GATC	2 cut(s)	316, 393
Sau96I	GGNCC	1 cut(s)	172
SchI	GAGTC	1 cut(s)	316
ScrFI	CCNGG	2 cut(s)	138, 391
SinI	GGWCC	1 cut(s)	172
SmlI	CTYRAG	2 cut(s)	47, 312
SmoI	CTYRAG	2 cut(s)	47, 312
SphI	GCATGC	1 cut(s)	148
Sse9I	AATT	5 cut(s)	66, 407, 459, 527, 600
SsiI	CCGC	1 cut(s)	208
SspMI	CTAG	3 cut(s)	104, 176, 614
StyD4I	CCNGG	2 cut(s)	136, 389
StyI	CCWWGG	1 cut(s)	175
TaaI	ACNGT	2 cut(s)	188, 266
TasI	AATT	5 cut(s)	66, 407, 459, 527, 600
TatI	WGTACW	1 cut(s)	348
TfiI	GAWTC	4 cut(s)	380, 414, 471, 483
Tru1I	TTAA	2 cut(s)	165, 579
Tru9I	TTAA	2 cut(s)	165, 579
TseI	GCWGC	3 cut(s)	107, 542, 565
TspDTI	ATGAA	3 cut(s)	210, 372, 564
TspGWI	ACGGA	1 cut(s)	495
VpaK11BI	GGWCC	1 cut(s)	172
XapI	RAATTY	2 cut(s)	459, 600
XbaI	TCTAGA	1 cut(s)	613
XceI	RCATGY	1 cut(s)	148
XmaJI	CCTAGG	1 cut(s)	175
XmiI	GTMKAC	1 cut(s)	261
XspI	CTAG	3 cut(s)	104, 176, 614

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.