Rmu_sc0007437.1_g000001

DNA cross-link repair protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007437.1
Physical Location & Seq
Forward (+)
1 .. 736
736 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007437.1_g000001.1.cds

Sequence Viewer

Length: 204 bp
taccctgtggtattgtcaaaaccaaaaggggggtatttgtggaattcgatagagtctaggttgattaagcctggagccgattggggttttggttctggtaatggcgaggatttcgaggagatcgatgtgctgctgaggctgaatgggattgaggaagaaggcgatggaatcattgagtatgaaaatgggggtttggtggtctag

Protein Analysis

67

Amino Acids

7.31

Weight (kDa)

4.15

Isoelectric Point (pI)

48.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 43
AfiI CCNNNNNNNGG 1 cut(s) 29
AjnI CCWGG 1 cut(s) 70
ApeKI GCWGC 1 cut(s) 130
ApoI RAATTY 1 cut(s) 43
BbvCI CCTCAGC 1 cut(s) 134
BbvI GCAGC 1 cut(s) 117
BccI CCATC 1 cut(s) 158
BciT130I CCWGG 1 cut(s) 72
BfaI CTAG 2 cut(s) 57, 202
BisI GCNGC 1 cut(s) 131
BlsI GCNGC 1 cut(s) 132
Bme1390I CCNGG 1 cut(s) 72
BmiI GGNNCC 1 cut(s) 76
BmrFI CCNGG 1 cut(s) 72
BpmI CTGGAG 1 cut(s) 93
Bpu10I CCTNAGC 1 cut(s) 134
Bsa29I ATCGAT 1 cut(s) 123
Bsc4I CCNNNNNNNGG 1 cut(s) 29
BseBI CCWGG 1 cut(s) 72
BseCI ATCGAT 1 cut(s) 123
BseLI CCNNNNNNNGG 1 cut(s) 29
BseMII CTCAG 1 cut(s) 125
BseRI GAGGAG 1 cut(s) 131
BseXI GCAGC 1 cut(s) 117
BshVI ATCGAT 1 cut(s) 123
BslI CCNNNNNNNGG 1 cut(s) 29
Bsp143I GATC 1 cut(s) 120
BspCNI CTCAG 1 cut(s) 126
BspDI ATCGAT 1 cut(s) 123
BspLI GGNNCC 1 cut(s) 76
BssMI GATC 1 cut(s) 120
Bst2UI CCWGG 1 cut(s) 72
BstDEI CTNAG 1 cut(s) 134
BstKTI GATC 1 cut(s) 123
BstMBI GATC 1 cut(s) 120
BstMWI GCNNNNNNNGC 1 cut(s) 136
BstNI CCWGG 1 cut(s) 72
BstSCI CCNGG 1 cut(s) 70
BstV1I GCAGC 1 cut(s) 117
Bsu15I ATCGAT 1 cut(s) 123
BsuTUI ATCGAT 1 cut(s) 123
BtgZI GCGATG 1 cut(s) 177
ClaI ATCGAT 1 cut(s) 123
CviJI RGCY 3 cut(s) 70, 77, 139
CviKI_1 RGCY 3 cut(s) 70, 77, 139
DdeI CTNAG 1 cut(s) 134
DpnI GATC 1 cut(s) 122
DpnII GATC 1 cut(s) 120
EcoRI GAATTC 1 cut(s) 43
EcoRII CCWGG 1 cut(s) 70
FaiI YATR 1 cut(s) 180
Fnu4HI GCNGC 1 cut(s) 131
Fsp4HI GCNGC 1 cut(s) 131
FspBI CTAG 2 cut(s) 57, 202
GluI GCNGC 1 cut(s) 131
GsuI CTGGAG 1 cut(s) 93
HinfI GANTC 2 cut(s) 53, 168
HpyAV CCTTC 1 cut(s) 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 136
HpyF3I CTNAG 1 cut(s) 134
Kzo9I GATC 1 cut(s) 120
LmnI GCTCC 1 cut(s) 74
LpnPI CCDG 4 cut(s) 18, 57, 81, 84
Lsp1109I GCAGC 1 cut(s) 117
MaeI CTAG 2 cut(s) 57, 202
MalI GATC 1 cut(s) 122
MboI GATC 1 cut(s) 120
MboII GAAGA 1 cut(s) 167
MluCI AATT 1 cut(s) 43
MlyI GAGTC 1 cut(s) 62
MnlI CCTC 4 cut(s) 100, 109, 129, 145
MseI TTAA 1 cut(s) 66
MspR9I CCNGG 1 cut(s) 72
MvaI CCWGG 1 cut(s) 72
MwoI GCNNNNNNNGC 1 cut(s) 136
NdeII GATC 1 cut(s) 120
NlaIV GGNNCC 1 cut(s) 76
PcsI WCGNNNNNNNCGW 1 cut(s) 120
PfeI GAWTC 1 cut(s) 168
PkrI GCNGC 1 cut(s) 132
PleI GAGTC 1 cut(s) 61
PpsI GAGTC 1 cut(s) 61
Psp6I CCWGG 1 cut(s) 70
PspGI CCWGG 1 cut(s) 70
PspN4I GGNNCC 1 cut(s) 76
SaqAI TTAA 1 cut(s) 66
SatI GCNGC 1 cut(s) 131
Sau3AI GATC 1 cut(s) 120
SchI GAGTC 1 cut(s) 62
ScrFI CCNGG 1 cut(s) 72
SetI ASST 1 cut(s) 62
SgeI CNNG 7 cut(s) 17, 69, 83, 84, 108, 118, 127
Sse9I AATT 1 cut(s) 43
SspMI CTAG 2 cut(s) 57, 202
StyD4I CCNGG 1 cut(s) 70
TaqI TCGA 3 cut(s) 47, 114, 123
TasI AATT 1 cut(s) 43
TfiI GAWTC 1 cut(s) 168
Tru1I TTAA 1 cut(s) 66
Tru9I TTAA 1 cut(s) 66
TseI GCWGC 1 cut(s) 130
TspDTI ATGAA 1 cut(s) 195
XapI RAATTY 1 cut(s) 43
XspI CTAG 2 cut(s) 57, 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.