Rmu_sc0007457.1_g000006

Converts alpha-aldose to the beta-anomer

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007457.1
OG0004802
Physical Location & Seq
Reverse (-)
43648 .. 45177
1530 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007457.1_g000006.1.cds

Sequence Viewer

Length: 1071 bp
atgaataagatatctttgtattggtgttttcttttcctgccattgatcttgagcttttctgaggcaaatgatgaaaaggtgggaaatatttatgaattgaagaagggaaatttctccgtgaagctgacgaattatggagcaactgtgctctctgttgttctccctgataagaatgggaagttagatgatgttgttcttgggtttgaatccctcaaagattacacaaatgattcggtctactttggggccaccgttgggcgtgttgctaatagaattggtggagctgaattcactttgaatggtcaccactataagttggttcctaatgatcatggaaagaacactctccatggtggctctaaaggattcagtgatgttctatggacagtgaagcatcacattgtagatagtcacataacgttcacctataatagtcgggatggtgaagaaggcttccctggtgatctttcagtctcagcaacatacatgtttattgaaccacacgctctagctattaaaatggaagccaaagctctcaccaaggccacaccagtaaacctagcccaccacacctactggaatctccgcggccacgccagtggtgacatcctctctcacaaaatccacatttttggatccaacatcaccccagtaaatgatgaactcatccctaccggcgacattgcccccgtgaaaggaacaccctacgatttccttgagccccgagagatcggtagcaggatcaatgagctgcctgatggttatgacatcaactacgttctggacccttccagccctgagcacttgaggaaggctgcagtgctgcatgacagtgtttctgggagaaaattggagctgtggactaaccagccagggctgcaattttacactagtaacatgctggatgatgtgaaagggaaaggtggatttgtgtataaaaagcatgccgcagtgtgcttggagacacagggtttcccagattccgtgaatcatccaaatttcccttcacaaattgtgaatccaggagacacttatctgcatgctatggtgtataggttcacagctaactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00010 ko00052 ko01100 ko01110 ko01120 ko01130 map00010 map00052 map01100 map01110 map01120 map01130
Pfam Domains
Protein Families
Aldose_epim

Protein Analysis

356

Amino Acids

39.48

Weight (kDa)

6.21

Isoelectric Point (pI)

29.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 237
AccII CGCG 1 cut(s) 588
AciI CCGC 3 cut(s) 586, 588, 948
AclI AACGTT 1 cut(s) 419
AclWI GGATC 3 cut(s) 630, 643, 749
AcoI YGGCCR 1 cut(s) 589
AcsI RAATTY 3 cut(s) 109, 287, 997
AfiI CCNNNNNNNGG 2 cut(s) 255, 695
AflIII ACRYGT 1 cut(s) 486
AgsI TTSAA 4 cut(s) 100, 206, 298, 497
AhlI ACTAGT 1 cut(s) 890
AjnI CCWGG 3 cut(s) 457, 871, 1021
AjuI GAANNNNNNNTTGG 2 cut(s) 988, 1020
AleI CACNNNNGTG 1 cut(s) 597
AluBI AGCT 8 cut(s) 54, 124, 284, 512, 533, 751, 856, 1064
AluI AGCT 8 cut(s) 54, 124, 284, 512, 533, 751, 856, 1064
Alw21I GWGCWC 2 cut(s) 150, 804
Alw26I GTCTC 3 cut(s) 478, 956, 1020
AlwI GGATC 3 cut(s) 630, 643, 749
Ama87I CYCGRG 1 cut(s) 723
AoxI GGCC 3 cut(s) 246, 543, 589
ApeKI GCWGC 4 cut(s) 751, 815, 823, 877
ApoI RAATTY 3 cut(s) 109, 287, 997
AspS9I GGNCC 2 cut(s) 246, 784
AsuHPI GGTGA 7 cut(s) 296, 415, 455, 473, 529, 614, 637
AvaI CYCGRG 1 cut(s) 723
AvaII GGWCC 1 cut(s) 784
BamHI GGATCC 1 cut(s) 635
BanII GRGCYC 1 cut(s) 723
Bbv12I GWGCWC 2 cut(s) 150, 804
BbvI GCAGC 4 cut(s) 738, 802, 810, 864
BccI CCATC 2 cut(s) 434, 752
BciT130I CCWGG 3 cut(s) 459, 873, 1023
BclI TGATCA 1 cut(s) 328
BcoDI GTCTC 3 cut(s) 478, 956, 1020
BcuI ACTAGT 1 cut(s) 890
BfaI CTAG 4 cut(s) 509, 560, 891, 1069
BfmI CTRYAG 1 cut(s) 816
BisI GCNGC 6 cut(s) 589, 752, 816, 824, 878, 948
BlsI GCNGC 6 cut(s) 590, 753, 817, 825, 879, 949
Bme1390I CCNGG 3 cut(s) 459, 873, 1023
Bme18I GGWCC 1 cut(s) 784
BmeT110I CYCGRG 1 cut(s) 723
BmgT120I GGNCC 2 cut(s) 246, 784
BmiI GGNNCC 4 cut(s) 247, 321, 637, 786
BmrFI CCNGG 3 cut(s) 459, 873, 1023
BmrI ACTGGG 1 cut(s) 644
BmsI GCATC 1 cut(s) 403
BmuI ACTGGG 1 cut(s) 644
Bpu10I CCTNAGC 1 cut(s) 798
BpuEI CTTGAG 3 cut(s) 70, 737, 826
BsaJI CCNNGG 5 cut(s) 349, 457, 540, 586, 872
BsaXI ACNNNNNCTCC 2 cut(s) 129, 159
Bsc4I CCNNNNNNNGG 2 cut(s) 255, 695
Bse118I RCCGGY 1 cut(s) 674
Bse1I ACTGG 4 cut(s) 551, 581, 597, 650
Bse3DI GCAATG 1 cut(s) 681
BseBI CCWGG 3 cut(s) 459, 873, 1023
BseDI CCNNGG 5 cut(s) 349, 457, 540, 586, 872
BseGI GGATG 5 cut(s) 445, 606, 666, 910, 991
BseLI CCNNNNNNNGG 2 cut(s) 255, 695
BseMI GCAATG 1 cut(s) 681
BseMII CTCAG 3 cut(s) 51, 489, 789
BseNI ACTGG 4 cut(s) 551, 581, 597, 650
BseXI GCAGC 4 cut(s) 738, 802, 810, 864
Bsh1236I CGCG 1 cut(s) 588
BshFI GGCC 3 cut(s) 248, 545, 591
BsiHKAI GWGCWC 2 cut(s) 150, 804
BsiHKCI CYCGRG 1 cut(s) 723
BsiSI CCGG 1 cut(s) 675
BslI CCNNNNNNNGG 2 cut(s) 255, 695
BsmAI GTCTC 3 cut(s) 478, 956, 1020
BsnI GGCC 3 cut(s) 248, 545, 591
BsoBI CYCGRG 1 cut(s) 723
Bsp1286I GDGCHC 3 cut(s) 150, 723, 804
Bsp143I GATC 6 cut(s) 45, 328, 463, 635, 729, 741
Bsp19I CCATGG 1 cut(s) 349
BspACI CCGC 3 cut(s) 586, 588, 948
BspANI GGCC 3 cut(s) 248, 545, 591
BspCNI CTCAG 3 cut(s) 52, 488, 790
BspFNI CGCG 1 cut(s) 588
BspLI GGNNCC 4 cut(s) 247, 321, 637, 786
BspMAI CTGCAG 1 cut(s) 820
BspPI GGATC 3 cut(s) 630, 643, 749
BsrDI GCAATG 1 cut(s) 681
BsrFI RCCGGY 1 cut(s) 674
BsrI ACTGG 4 cut(s) 551, 581, 597, 650
BssAI RCCGGY 1 cut(s) 674
BssECI CCNNGG 5 cut(s) 349, 457, 540, 586, 872
BssMI GATC 6 cut(s) 45, 328, 463, 635, 729, 741
BssT1I CCWWGG 2 cut(s) 349, 540
Bst2UI CCWGG 3 cut(s) 459, 873, 1023
Bst4CI ACNGT 4 cut(s) 145, 253, 388, 833
BstC8I GCNNGC 2 cut(s) 945, 1041
BstDEI CTNAG 3 cut(s) 60, 475, 798
BstDSI CCRYGG 2 cut(s) 349, 586
BstEII GGTNACC 1 cut(s) 302
BstF5I GGATG 5 cut(s) 445, 606, 666, 910, 991
BstFNI CGCG 1 cut(s) 588
BstKTI GATC 6 cut(s) 48, 331, 466, 638, 732, 744
BstMAI GTCTC 3 cut(s) 478, 956, 1020
BstMBI GATC 6 cut(s) 45, 328, 463, 635, 729, 741
BstMWI GCNNNNNNNGC 1 cut(s) 877
BstNI CCWGG 3 cut(s) 459, 873, 1023
BstNSI RCATGY 4 cut(s) 490, 901, 947, 1043
BstPI GGTNACC 1 cut(s) 302
BstSCI CCNGG 3 cut(s) 457, 871, 1021
BstSFI CTRYAG 1 cut(s) 816
BstUI CGCG 1 cut(s) 588
BstV1I GCAGC 4 cut(s) 738, 802, 810, 864
BstX2I RGATCY 1 cut(s) 635
BstXI CCANNNNNNTGG 2 cut(s) 599, 632
BstYI RGATCY 1 cut(s) 635
BsuRI GGCC 3 cut(s) 248, 545, 591
BtgI CCRYGG 2 cut(s) 349, 586
BtsCI GGATG 5 cut(s) 445, 606, 666, 910, 991
BtsI GCAGTG 2 cut(s) 825, 957
BtsIMutI CAGTG 6 cut(s) 376, 393, 604, 825, 838, 957
Cac8I GCNNGC 2 cut(s) 945, 1041
Cfr10I RCCGGY 1 cut(s) 674
Cfr13I GGNCC 2 cut(s) 246, 784
Cfr42I CCGCGG 1 cut(s) 589
CviAII CATG 7 cut(s) 332, 350, 487, 827, 898, 944, 1040
DdeI CTNAG 3 cut(s) 60, 475, 798
DpnI GATC 6 cut(s) 47, 330, 465, 637, 731, 743
DpnII GATC 6 cut(s) 45, 328, 463, 635, 729, 741
EaeI YGGCCR 1 cut(s) 589
Eco130I CCWWGG 2 cut(s) 349, 540
Eco24I GRGCYC 1 cut(s) 723
Eco32I GATATC 1 cut(s) 12
Eco47I GGWCC 1 cut(s) 784
Eco88I CYCGRG 1 cut(s) 723
Eco91I GGTNACC 1 cut(s) 302
EcoO65I GGTNACC 1 cut(s) 302
EcoRI GAATTC 1 cut(s) 287
EcoRII CCWGG 3 cut(s) 457, 871, 1021
EcoRV GATATC 1 cut(s) 12
EcoT14I CCWWGG 2 cut(s) 349, 540
EcoT38I GRGCYC 1 cut(s) 723
ErhI CCWWGG 2 cut(s) 349, 540
FaeI CATG 7 cut(s) 335, 353, 490, 830, 901, 947, 1043
FatI CATG 7 cut(s) 331, 349, 486, 826, 897, 943, 1039
FbaI TGATCA 1 cut(s) 328
FblI GTMKAC 1 cut(s) 237
Fnu4HI GCNGC 6 cut(s) 589, 752, 816, 824, 878, 948
FokI GGATG 5 cut(s) 452, 593, 653, 917, 978
FriOI GRGCYC 1 cut(s) 723
Fsp4HI GCNGC 6 cut(s) 589, 752, 816, 824, 878, 948
FspBI CTAG 4 cut(s) 509, 560, 891, 1069
GluI GCNGC 6 cut(s) 589, 752, 816, 824, 878, 948
HaeIII GGCC 3 cut(s) 248, 545, 591
HapII CCGG 1 cut(s) 675
Hin1II CATG 7 cut(s) 335, 353, 490, 830, 901, 947, 1043
HinfI GANTC 7 cut(s) 206, 230, 366, 580, 980, 988, 1018
HpaII CCGG 1 cut(s) 675
HphI GGTGA 7 cut(s) 296, 415, 455, 473, 529, 614, 637
Hpy166II GTNNAC 5 cut(s) 238, 423, 556, 861, 1059
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 3 cut(s) 49, 437, 782
Hpy8I GTNNAC 5 cut(s) 238, 423, 556, 861, 1059
HpyAV CCTTC 5 cut(s) 97, 443, 798, 805, 1014
HpyCH4III ACNGT 4 cut(s) 145, 253, 388, 833
HpyCH4IV ACGT 2 cut(s) 419, 777
HpyCH4V TGCA 4 cut(s) 818, 826, 880, 1039
HpyF10VI GCNNNNNNNGC 1 cut(s) 877
HpyF3I CTNAG 3 cut(s) 60, 475, 798
HpySE526I ACGT 2 cut(s) 419, 777
Hsp92II CATG 7 cut(s) 335, 353, 490, 830, 901, 947, 1043
Ksp22I TGATCA 1 cut(s) 328
KspI CCGCGG 1 cut(s) 589
Kzo9I GATC 6 cut(s) 45, 328, 463, 635, 729, 741
LmnI GCTCC 3 cut(s) 137, 281, 853
Lsp1109I GCAGC 4 cut(s) 738, 802, 810, 864
LweI GCATC 1 cut(s) 403
MaeI CTAG 4 cut(s) 509, 560, 891, 1069
MaeII ACGT 2 cut(s) 419, 777
MaeIII GTNAC 4 cut(s) 302, 410, 602, 893
MalI GATC 6 cut(s) 47, 330, 465, 637, 731, 743
MboI GATC 6 cut(s) 45, 328, 463, 635, 729, 741
MboII GAAGA 2 cut(s) 112, 458
MflI RGATCY 1 cut(s) 635
MhlI GDGCHC 3 cut(s) 150, 723, 804
MluCI AATT 9 cut(s) 95, 109, 130, 273, 287, 848, 881, 997, 1011
MmeI TCCRAC 1 cut(s) 663
MnlI CCTC 4 cut(s) 55, 221, 620, 801
MseI TTAA 1 cut(s) 516
MslI CAYNNNNRTG 2 cut(s) 597, 831
MspA1I CMGCKG 1 cut(s) 588
MspI CCGG 1 cut(s) 675
MspR9I CCNGG 3 cut(s) 459, 873, 1023
MvaI CCWGG 3 cut(s) 459, 873, 1023
MvnI CGCG 1 cut(s) 588
MwoI GCNNNNNNNGC 1 cut(s) 877
NcoI CCATGG 1 cut(s) 349
NdeII GATC 6 cut(s) 45, 328, 463, 635, 729, 741
NlaIII CATG 7 cut(s) 335, 353, 490, 830, 901, 947, 1043
NlaIV GGNNCC 4 cut(s) 247, 321, 637, 786
NmuCI GTSAC 3 cut(s) 302, 410, 602
NspI RCATGY 4 cut(s) 490, 901, 947, 1043
OliI CACNNNNGTG 1 cut(s) 597
PaeI GCATGC 2 cut(s) 947, 1043
PciI ACATGT 1 cut(s) 486
PfeI GAWTC 7 cut(s) 206, 230, 366, 580, 980, 988, 1018
PfoI TCCNGGA 1 cut(s) 1021
PkrI GCNGC 6 cut(s) 590, 753, 817, 825, 879, 949
PscI ACATGT 1 cut(s) 486
Psp1406I AACGTT 1 cut(s) 419
Psp6I CCWGG 3 cut(s) 457, 871, 1021
PspEI GGTNACC 1 cut(s) 302
PspGI CCWGG 3 cut(s) 457, 871, 1021
PspN4I GGNNCC 4 cut(s) 247, 321, 637, 786
PspPI GGNCC 2 cut(s) 246, 784
PstI CTGCAG 1 cut(s) 820
PsuI RGATCY 1 cut(s) 635
RseI CAYNNNNRTG 2 cut(s) 597, 831
SacII CCGCGG 1 cut(s) 589
SaqAI TTAA 1 cut(s) 516
SatI GCNGC 6 cut(s) 589, 752, 816, 824, 878, 948
Sau3AI GATC 6 cut(s) 45, 328, 463, 635, 729, 741
Sau96I GGNCC 2 cut(s) 246, 784
ScrFI CCNGG 3 cut(s) 459, 873, 1023
SduI GDGCHC 3 cut(s) 150, 723, 804
SfaNI GCATC 1 cut(s) 403
SfcI CTRYAG 1 cut(s) 816
Sfr303I CCGCGG 1 cut(s) 589
SgrBI CCGCGG 1 cut(s) 589
SinI GGWCC 1 cut(s) 784
SmiMI CAYNNNNRTG 2 cut(s) 597, 831
SmlI CTYRAG 3 cut(s) 49, 716, 805
SmoI CTYRAG 3 cut(s) 49, 716, 805
SpeI ACTAGT 1 cut(s) 890
SphI GCATGC 2 cut(s) 947, 1043
Sse9I AATT 9 cut(s) 95, 109, 130, 273, 287, 848, 881, 997, 1011
SsiI CCGC 3 cut(s) 586, 588, 948
SspI AATATT 1 cut(s) 88
SspMI CTAG 4 cut(s) 509, 560, 891, 1069
StyD4I CCNGG 3 cut(s) 457, 871, 1021
StyI CCWWGG 2 cut(s) 349, 540
TaaI ACNGT 4 cut(s) 145, 253, 388, 833
TaiI ACGT 2 cut(s) 422, 780
TaqII GACCGA 1 cut(s) 223
TasI AATT 9 cut(s) 95, 109, 130, 273, 287, 848, 881, 997, 1011
TauI GCSGC 2 cut(s) 591, 950
TfiI GAWTC 7 cut(s) 206, 230, 366, 580, 980, 988, 1018
Tru1I TTAA 1 cut(s) 516
Tru9I TTAA 1 cut(s) 516
TscAI CASTG 6 cut(s) 376, 393, 604, 825, 838, 957
TseFI GTSAC 3 cut(s) 302, 410, 602
TseI GCWGC 4 cut(s) 751, 815, 823, 877
Tsp45I GTSAC 3 cut(s) 302, 410, 602
TspDTI ATGAA 4 cut(s) 17, 87, 108, 675
TspGWI ACGGA 2 cut(s) 106, 973
TspRI CASTG 6 cut(s) 376, 393, 604, 825, 838, 957
VpaK11BI GGWCC 1 cut(s) 784
XapI RAATTY 3 cut(s) 109, 287, 997
XceI RCATGY 4 cut(s) 490, 901, 947, 1043
XmiI GTMKAC 1 cut(s) 237
XspI CTAG 4 cut(s) 509, 560, 891, 1069
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.