Rmu_sc0008351.1_g000001

Aux IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008351.1
Physical Location & Seq
Forward (+)
2525 .. 4430
1906 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008351.1_g000001.1.cds

Sequence Viewer

Length: 870 bp
atggaaggcactctgggattacttggaggtgggtcttctgggtgctcaacaaatgagtcagcaatgtcaaaggtggaacaacaggtggtggagcaagactatgtgggcatgtcctctgaggtatcttcatacccagctgaaactgagcttgaactgggcctgagcctgggtggtggtggttctgcacagaagtccaaagcctgtgcatggggcgagcgtggaagaatcttgactgctaaagacttcccttccatggtgtctcatgggtctgcaagattctcacagagagcaaataatgcttcttctgtttctggaaataagagggctgctgaagagggtggatctcccactgctgtaagtgctgcaaggatgaacagcttggttaaccaggcaaagactgcaaggtctgaagatgacaaggcagatggggacaattctaaggacacttacaagaagaaaatcaacactggtaataagtcaactgtgaaagagaaagggcatctgggatttgtgaaggttaacatggatggaattcctatagggaggaaagtggatttaaatgctcacacttgctatgagactttagctcaaacacttgaggacatgttcttcagcaccactacaactggcaattcaatcggtggagacaaggaacaagcaacaaaaccctcaaggcttctggatggatcctccgagtttgtgctcacttatgaagataaagacggagactggatgcttgttggagatgtcccttggaggatgttcctcacctcggtgaaaaggcttcgaataatgaggacctctgaggccaacggacttgctccaagatttcaagaaaggagtgagagacaaagaaacagacctatataa

Protein Analysis

289

Amino Acids

31.15

Weight (kDa)

7.67

Isoelectric Point (pI)

38.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 403
AclWI GGATC 3 cut(s) 349, 681, 694
AcsI RAATTY 1 cut(s) 531
AcuI CTGAAG 3 cut(s) 351, 429, 595
AfiI CCNNNNNNNGG 4 cut(s) 166, 207, 253, 772
AflIII ACRYGT 1 cut(s) 603
AgsI TTSAA 3 cut(s) 152, 636, 833
AjnI CCWGG 2 cut(s) 165, 387
AleI CACNNNNGTG 1 cut(s) 773
AluBI AGCT 4 cut(s) 137, 148, 378, 587
AluI AGCT 4 cut(s) 137, 148, 378, 587
Alw21I GWGCWC 2 cut(s) 47, 705
Alw26I GTCTC 5 cut(s) 264, 572, 639, 720, 841
AlwI GGATC 3 cut(s) 349, 681, 694
AoxI GGCC 2 cut(s) 157, 807
ApeKI GCWGC 2 cut(s) 326, 362
ApoI RAATTY 1 cut(s) 531
AspS9I GGNCC 2 cut(s) 157, 798
AsuHPI GGTGA 2 cut(s) 760, 787
AsuII TTCGAA 1 cut(s) 787
AvaII GGWCC 1 cut(s) 798
BamHI GGATCC 1 cut(s) 686
BbsI GAAGAC 1 cut(s) 27
Bbv12I GWGCWC 2 cut(s) 47, 705
BbvI GCAGC 2 cut(s) 313, 349
BccI CCATC 3 cut(s) 419, 521, 677
BcgI CGANNNNNNTGC 2 cut(s) 619, 653
BciT130I CCWGG 2 cut(s) 167, 389
BcoDI GTCTC 5 cut(s) 264, 572, 639, 720, 841
BfmI CTRYAG 1 cut(s) 537
BisI GCNGC 2 cut(s) 327, 363
BlsI GCNGC 2 cut(s) 328, 364
Bme1390I CCNGG 2 cut(s) 167, 389
Bme18I GGWCC 1 cut(s) 798
BmgT120I GGNCC 2 cut(s) 157, 798
BmiI GGNNCC 1 cut(s) 688
BmrFI CCNGG 2 cut(s) 167, 389
BmrI ACTGGG 1 cut(s) 164
BmsI GCATC 2 cut(s) 508, 723
BmuI ACTGGG 1 cut(s) 164
BpiI GAAGAC 1 cut(s) 27
Bpu10I CCTNAGC 1 cut(s) 161
Bpu14I TTCGAA 1 cut(s) 787
BpuEI CTTGAG 2 cut(s) 617, 655
BsaJI CCNNGG 4 cut(s) 166, 252, 752, 771
Bsc4I CCNNNNNNNGG 4 cut(s) 166, 207, 253, 772
Bse1I ACTGG 4 cut(s) 159, 472, 631, 734
Bse3DI GCAATG 1 cut(s) 69
BseBI CCWGG 2 cut(s) 167, 389
BseDI CCNNGG 4 cut(s) 166, 252, 752, 771
BseGI GGATG 5 cut(s) 375, 532, 688, 738, 765
BseLI CCNNNNNNNGG 4 cut(s) 166, 207, 253, 772
BseMI GCAATG 1 cut(s) 69
BseMII CTCAG 4 cut(s) 108, 135, 152, 795
BseNI ACTGG 4 cut(s) 159, 472, 631, 734
BseXI GCAGC 2 cut(s) 313, 349
BseYI CCCAGC 1 cut(s) 133
BsgI GTGCAG 1 cut(s) 168
BshFI GGCC 2 cut(s) 159, 809
BsiHKAI GWGCWC 2 cut(s) 47, 705
BslFI GGGAC 2 cut(s) 443, 734
BslI CCNNNNNNNGG 4 cut(s) 166, 207, 253, 772
BsmAI GTCTC 5 cut(s) 264, 572, 639, 720, 841
BsmFI GGGAC 2 cut(s) 443, 734
BsnI GGCC 2 cut(s) 159, 809
Bsp119I TTCGAA 1 cut(s) 787
Bsp1286I GDGCHC 2 cut(s) 47, 705
Bsp143I GATC 2 cut(s) 341, 686
Bsp19I CCATGG 1 cut(s) 252
BspANI GGCC 2 cut(s) 159, 809
BspCNI CTCAG 4 cut(s) 109, 136, 153, 796
BspLI GGNNCC 1 cut(s) 688
BspPI GGATC 3 cut(s) 349, 681, 694
BspT104I TTCGAA 1 cut(s) 787
BsrDI GCAATG 1 cut(s) 69
BsrI ACTGG 4 cut(s) 159, 472, 631, 734
BssECI CCNNGG 4 cut(s) 166, 252, 752, 771
BssMI GATC 2 cut(s) 341, 686
BssT1I CCWWGG 2 cut(s) 252, 752
Bst2UI CCWGG 2 cut(s) 167, 389
Bst4CI ACNGT 1 cut(s) 484
Bst6I CTCTTC 1 cut(s) 327
BstAPI GCANNNNNTGC 2 cut(s) 296, 398
BstBI TTCGAA 1 cut(s) 787
BstC8I GCNNGC 1 cut(s) 215
BstDEI CTNAG 5 cut(s) 117, 144, 161, 438, 804
BstDSI CCRYGG 1 cut(s) 252
BstF5I GGATG 5 cut(s) 375, 532, 688, 738, 765
BstKTI GATC 2 cut(s) 344, 689
BstMAI GTCTC 5 cut(s) 264, 572, 639, 720, 841
BstMBI GATC 2 cut(s) 341, 686
BstMWI GCNNNNNNNGC 3 cut(s) 296, 359, 398
BstNI CCWGG 2 cut(s) 167, 389
BstNSI RCATGY 2 cut(s) 112, 607
BstSCI CCNGG 2 cut(s) 165, 387
BstSFI CTRYAG 1 cut(s) 537
BstV1I GCAGC 2 cut(s) 313, 349
BstV2I GAAGAC 1 cut(s) 27
BstX2I RGATCY 2 cut(s) 341, 686
BstYI RGATCY 2 cut(s) 341, 686
BsuRI GGCC 2 cut(s) 159, 809
BtgI CCRYGG 1 cut(s) 252
BtsCI GGATG 5 cut(s) 375, 532, 688, 738, 765
BtsI GCAGTG 1 cut(s) 348
BtsIMutI CAGTG 2 cut(s) 348, 465
Cac8I GCNNGC 1 cut(s) 215
Cfr13I GGNCC 2 cut(s) 157, 798
CviAII CATG 6 cut(s) 109, 207, 253, 263, 523, 604
DdeI CTNAG 5 cut(s) 117, 144, 161, 438, 804
DpnI GATC 2 cut(s) 343, 688
DpnII GATC 2 cut(s) 341, 686
DraI TTTAAA 1 cut(s) 558
DrdI GACNNNNNNGTC 1 cut(s) 403
DseDI GACNNNNNNGTC 1 cut(s) 403
Eam1104I CTCTTC 1 cut(s) 327
EarI CTCTTC 1 cut(s) 327
Eco130I CCWWGG 2 cut(s) 252, 752
Eco47I GGWCC 1 cut(s) 798
Eco57I CTGAAG 3 cut(s) 351, 429, 595
EcoO109I RGGNCCY 1 cut(s) 798
EcoRI GAATTC 1 cut(s) 531
EcoRII CCWGG 2 cut(s) 165, 387
EcoT14I CCWWGG 2 cut(s) 252, 752
ErhI CCWWGG 2 cut(s) 252, 752
FaeI CATG 6 cut(s) 112, 210, 256, 266, 526, 607
FaqI GGGAC 2 cut(s) 443, 734
FatI CATG 6 cut(s) 108, 206, 252, 262, 522, 603
Fnu4HI GCNGC 2 cut(s) 327, 363
FokI GGATG 5 cut(s) 382, 539, 695, 745, 772
Fsp4HI GCNGC 2 cut(s) 327, 363
GluI GCNGC 2 cut(s) 327, 363
GsaI CCCAGC 1 cut(s) 137
HaeIII GGCC 2 cut(s) 159, 809
Hin1II CATG 6 cut(s) 112, 210, 256, 266, 526, 607
HincII GTYRAC 3 cut(s) 385, 480, 520
HindII GTYRAC 3 cut(s) 385, 480, 520
HinfI GANTC 3 cut(s) 56, 225, 276
HpaI GTTAAC 2 cut(s) 385, 520
HphI GGTGA 2 cut(s) 760, 787
Hpy166II GTNNAC 3 cut(s) 385, 480, 520
Hpy188I TCNGA 4 cut(s) 118, 409, 694, 805
Hpy188III TCNNGA 4 cut(s) 229, 312, 680, 833
Hpy8I GTNNAC 3 cut(s) 385, 480, 520
HpyAV CCTTC 2 cut(s) 258, 508
HpyCH4III ACNGT 1 cut(s) 484
HpyCH4V TGCA 5 cut(s) 185, 206, 272, 365, 401
HpyF10VI GCNNNNNNNGC 3 cut(s) 296, 359, 398
HpyF3I CTNAG 5 cut(s) 117, 144, 161, 438, 804
Hsp92II CATG 6 cut(s) 112, 210, 256, 266, 526, 607
KspAI GTTAAC 2 cut(s) 385, 520
Kzo9I GATC 2 cut(s) 341, 686
LmnI GCTCC 2 cut(s) 91, 826
Lsp1109I GCAGC 2 cut(s) 313, 349
LweI GCATC 2 cut(s) 508, 723
MalI GATC 2 cut(s) 343, 688
MboI GATC 2 cut(s) 341, 686
MboII GAAGA 9 cut(s) 27, 117, 234, 294, 344, 422, 466, 601, 725
MflI RGATCY 2 cut(s) 341, 686
MhlI GDGCHC 2 cut(s) 47, 705
MluCI AATT 3 cut(s) 433, 531, 631
MlyI GAGTC 1 cut(s) 65
MmeI TCCRAC 1 cut(s) 721
MseI TTAA 3 cut(s) 384, 519, 557
MslI CAYNNNNRTG 1 cut(s) 773
MspA1I CMGCKG 1 cut(s) 137
MspR9I CCNGG 2 cut(s) 167, 389
MvaI CCWGG 2 cut(s) 167, 389
MwoI GCNNNNNNNGC 3 cut(s) 296, 359, 398
NcoI CCATGG 1 cut(s) 252
NdeII GATC 2 cut(s) 341, 686
NlaIII CATG 6 cut(s) 112, 210, 256, 266, 526, 607
NlaIV GGNNCC 1 cut(s) 688
NspI RCATGY 2 cut(s) 112, 607
NspV TTCGAA 1 cut(s) 787
OliI CACNNNNGTG 1 cut(s) 773
PciI ACATGT 1 cut(s) 603
PfeI GAWTC 2 cut(s) 225, 276
PkrI GCNGC 2 cut(s) 328, 364
PleI GAGTC 1 cut(s) 64
PpsI GAGTC 1 cut(s) 64
PpuMI RGGWCCY 1 cut(s) 798
PscI ACATGT 1 cut(s) 603
Psp5II RGGWCCY 1 cut(s) 798
Psp6I CCWGG 2 cut(s) 165, 387
PspFI CCCAGC 1 cut(s) 133
PspGI CCWGG 2 cut(s) 165, 387
PspN4I GGNNCC 1 cut(s) 688
PspPI GGNCC 2 cut(s) 157, 798
PspPPI RGGWCCY 1 cut(s) 798
PsuI RGATCY 2 cut(s) 341, 686
PvuII CAGCTG 1 cut(s) 137
RseI CAYNNNNRTG 1 cut(s) 773
SaqAI TTAA 3 cut(s) 384, 519, 557
SatI GCNGC 2 cut(s) 327, 363
Sau3AI GATC 2 cut(s) 341, 686
Sau96I GGNCC 2 cut(s) 157, 798
SchI GAGTC 1 cut(s) 65
ScrFI CCNGG 2 cut(s) 167, 389
SduI GDGCHC 2 cut(s) 47, 705
SfaNI GCATC 2 cut(s) 508, 723
SfcI CTRYAG 1 cut(s) 537
SfuI TTCGAA 1 cut(s) 787
SinI GGWCC 1 cut(s) 798
SmiI ATTTAAAT 1 cut(s) 558
SmiMI CAYNNNNRTG 1 cut(s) 773
SmlI CTYRAG 2 cut(s) 596, 670
SmoI CTYRAG 2 cut(s) 596, 670
Sse9I AATT 3 cut(s) 433, 531, 631
StyD4I CCNGG 2 cut(s) 165, 387
StyI CCWWGG 2 cut(s) 252, 752
SwaI ATTTAAAT 1 cut(s) 558
TaaI ACNGT 1 cut(s) 484
TaqI TCGA 1 cut(s) 787
TasI AATT 3 cut(s) 433, 531, 631
TfiI GAWTC 2 cut(s) 225, 276
Tru1I TTAA 3 cut(s) 384, 519, 557
Tru9I TTAA 3 cut(s) 384, 519, 557
TscAI CASTG 2 cut(s) 355, 472
TseI GCWGC 2 cut(s) 326, 362
TspDTI ATGAA 3 cut(s) 117, 386, 726
TspGWI ACGGA 2 cut(s) 738, 828
TspRI CASTG 2 cut(s) 355, 472
VpaK11BI GGWCC 1 cut(s) 798
XapI RAATTY 1 cut(s) 531
XceI RCATGY 2 cut(s) 112, 607
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.