Rmu_sc0025234.1_g000002

Aux IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0025234.1
Physical Location & Seq
Forward (+)
6562 .. 8467
1906 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0025234.1_g000002.1.cds

Sequence Viewer

Length: 897 bp
atggaaggcactctgggattacttggaggtgggtcttctgggtgctcaacaaatgagtcagcaatgtcaaaggtggaacaacaggtggtggagcaagactatgtgggcatgtcctctgaggtatcttcatacccagctgaaactgagcttgaactgggcctgagcctgggtggtggtggttctgcacagaagtccaaagcctgtgcatggggcgagcgtggaagaatcttgactgctaaagacttcccttccatggtgtctcatgggtctgcaagattctcacagagagcaaataatgcttcttctgtttctggaaataagagggctgctgaagagggtggatctcccactgctgtaagtcaagttgtgggatggccacctataagtgctgcaaggatgaacagcttggttaaccaggcaaagactgcaaggtctgaagatgacaaggcagatggggacaattctaaggacacttacaagaagaaaatcaacactggtaataagtcaactgtgaaagagaaagggcatctgggatttgtgaaggttaacatggatggaattcctatagggaggaaagtggatttaaatgctcacacttgctatgagactttagctcaaacacttgaggacatgttcttcagcaccactacaactggcaattcaatcggtggagacaaggaacaagcaacaaaaccctcaaggcttctggatggatcctccgagtttgtgctcacttatgaagataaagacggagactggatgcttgttggagatgtcccttggaggatgttcctcacctcggtgaaaaggcttcgaataatgaggacctctgaggccaacggacttgctccaagatttcaagaaaggagtgagagacaaagaaacagacctatataa

Protein Analysis

298

Amino Acids

32.12

Weight (kDa)

7.67

Isoelectric Point (pI)

38.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 430
AclWI GGATC 3 cut(s) 349, 708, 721
AcoI YGGCCR 1 cut(s) 374
AcsI RAATTY 1 cut(s) 558
AcuI CTGAAG 3 cut(s) 351, 456, 622
AfiI CCNNNNNNNGG 4 cut(s) 166, 207, 253, 799
AflIII ACRYGT 1 cut(s) 630
AgsI TTSAA 3 cut(s) 152, 663, 860
AjnI CCWGG 2 cut(s) 165, 414
AleI CACNNNNGTG 1 cut(s) 800
AluBI AGCT 4 cut(s) 137, 148, 405, 614
AluI AGCT 4 cut(s) 137, 148, 405, 614
Alw21I GWGCWC 2 cut(s) 47, 732
Alw26I GTCTC 5 cut(s) 264, 599, 666, 747, 868
AlwI GGATC 3 cut(s) 349, 708, 721
AoxI GGCC 3 cut(s) 157, 374, 834
ApeKI GCWGC 2 cut(s) 326, 389
ApoI RAATTY 1 cut(s) 558
AspS9I GGNCC 2 cut(s) 157, 825
AsuHPI GGTGA 2 cut(s) 787, 814
AsuII TTCGAA 1 cut(s) 814
AvaII GGWCC 1 cut(s) 825
BalI TGGCCA 1 cut(s) 376
BamHI GGATCC 1 cut(s) 713
BbsI GAAGAC 1 cut(s) 27
Bbv12I GWGCWC 2 cut(s) 47, 732
BbvI GCAGC 2 cut(s) 313, 376
BccI CCATC 4 cut(s) 366, 446, 548, 704
BcgI CGANNNNNNTGC 2 cut(s) 646, 680
BciT130I CCWGG 2 cut(s) 167, 416
BcoDI GTCTC 5 cut(s) 264, 599, 666, 747, 868
BfmI CTRYAG 1 cut(s) 564
BisI GCNGC 2 cut(s) 327, 390
BlsI GCNGC 2 cut(s) 328, 391
Bme1390I CCNGG 2 cut(s) 167, 416
Bme18I GGWCC 1 cut(s) 825
BmgT120I GGNCC 2 cut(s) 157, 825
BmiI GGNNCC 1 cut(s) 715
BmrFI CCNGG 2 cut(s) 167, 416
BmrI ACTGGG 1 cut(s) 164
BmsI GCATC 2 cut(s) 535, 750
BmuI ACTGGG 1 cut(s) 164
BpiI GAAGAC 1 cut(s) 27
Bpu10I CCTNAGC 1 cut(s) 161
Bpu14I TTCGAA 1 cut(s) 814
BpuEI CTTGAG 2 cut(s) 644, 682
BsaJI CCNNGG 4 cut(s) 166, 252, 779, 798
Bsc4I CCNNNNNNNGG 4 cut(s) 166, 207, 253, 799
Bse1I ACTGG 4 cut(s) 159, 499, 658, 761
Bse3DI GCAATG 1 cut(s) 69
BseBI CCWGG 2 cut(s) 167, 416
BseDI CCNNGG 4 cut(s) 166, 252, 779, 798
BseGI GGATG 6 cut(s) 377, 402, 559, 715, 765, 792
BseLI CCNNNNNNNGG 4 cut(s) 166, 207, 253, 799
BseMI GCAATG 1 cut(s) 69
BseMII CTCAG 4 cut(s) 108, 135, 152, 822
BseNI ACTGG 4 cut(s) 159, 499, 658, 761
BseXI GCAGC 2 cut(s) 313, 376
BseYI CCCAGC 1 cut(s) 133
BsgI GTGCAG 1 cut(s) 168
BshFI GGCC 3 cut(s) 159, 376, 836
BsiHKAI GWGCWC 2 cut(s) 47, 732
BslFI GGGAC 2 cut(s) 470, 761
BslI CCNNNNNNNGG 4 cut(s) 166, 207, 253, 799
BsmAI GTCTC 5 cut(s) 264, 599, 666, 747, 868
BsmFI GGGAC 2 cut(s) 470, 761
BsnI GGCC 3 cut(s) 159, 376, 836
Bsp119I TTCGAA 1 cut(s) 814
Bsp1286I GDGCHC 2 cut(s) 47, 732
Bsp143I GATC 2 cut(s) 341, 713
Bsp19I CCATGG 1 cut(s) 252
BspANI GGCC 3 cut(s) 159, 376, 836
BspCNI CTCAG 4 cut(s) 109, 136, 153, 823
BspLI GGNNCC 1 cut(s) 715
BspPI GGATC 3 cut(s) 349, 708, 721
BspT104I TTCGAA 1 cut(s) 814
BsrDI GCAATG 1 cut(s) 69
BsrI ACTGG 4 cut(s) 159, 499, 658, 761
BssECI CCNNGG 4 cut(s) 166, 252, 779, 798
BssMI GATC 2 cut(s) 341, 713
BssT1I CCWWGG 2 cut(s) 252, 779
Bst2UI CCWGG 2 cut(s) 167, 416
Bst4CI ACNGT 1 cut(s) 511
Bst6I CTCTTC 1 cut(s) 327
BstAPI GCANNNNNTGC 2 cut(s) 296, 425
BstBI TTCGAA 1 cut(s) 814
BstC8I GCNNGC 1 cut(s) 215
BstDEI CTNAG 5 cut(s) 117, 144, 161, 465, 831
BstDSI CCRYGG 1 cut(s) 252
BstF5I GGATG 6 cut(s) 377, 402, 559, 715, 765, 792
BstKTI GATC 2 cut(s) 344, 716
BstMAI GTCTC 5 cut(s) 264, 599, 666, 747, 868
BstMBI GATC 2 cut(s) 341, 713
BstMWI GCNNNNNNNGC 2 cut(s) 296, 425
BstNI CCWGG 2 cut(s) 167, 416
BstNSI RCATGY 2 cut(s) 112, 634
BstSCI CCNGG 2 cut(s) 165, 414
BstSFI CTRYAG 1 cut(s) 564
BstV1I GCAGC 2 cut(s) 313, 376
BstV2I GAAGAC 1 cut(s) 27
BstX2I RGATCY 2 cut(s) 341, 713
BstYI RGATCY 2 cut(s) 341, 713
BsuRI GGCC 3 cut(s) 159, 376, 836
BtgI CCRYGG 1 cut(s) 252
BtsCI GGATG 6 cut(s) 377, 402, 559, 715, 765, 792
BtsI GCAGTG 1 cut(s) 348
BtsIMutI CAGTG 2 cut(s) 348, 492
Cac8I GCNNGC 1 cut(s) 215
Cfr13I GGNCC 2 cut(s) 157, 825
CviAII CATG 6 cut(s) 109, 207, 253, 263, 550, 631
DdeI CTNAG 5 cut(s) 117, 144, 161, 465, 831
DpnI GATC 2 cut(s) 343, 715
DpnII GATC 2 cut(s) 341, 713
DraI TTTAAA 1 cut(s) 585
DrdI GACNNNNNNGTC 1 cut(s) 430
DseDI GACNNNNNNGTC 1 cut(s) 430
EaeI YGGCCR 1 cut(s) 374
Eam1104I CTCTTC 1 cut(s) 327
EarI CTCTTC 1 cut(s) 327
Eco130I CCWWGG 2 cut(s) 252, 779
Eco47I GGWCC 1 cut(s) 825
Eco57I CTGAAG 3 cut(s) 351, 456, 622
EcoO109I RGGNCCY 1 cut(s) 825
EcoRI GAATTC 1 cut(s) 558
EcoRII CCWGG 2 cut(s) 165, 414
EcoT14I CCWWGG 2 cut(s) 252, 779
ErhI CCWWGG 2 cut(s) 252, 779
FaeI CATG 6 cut(s) 112, 210, 256, 266, 553, 634
FaqI GGGAC 2 cut(s) 470, 761
FatI CATG 6 cut(s) 108, 206, 252, 262, 549, 630
Fnu4HI GCNGC 2 cut(s) 327, 390
FokI GGATG 6 cut(s) 384, 409, 566, 722, 772, 799
Fsp4HI GCNGC 2 cut(s) 327, 390
GluI GCNGC 2 cut(s) 327, 390
GsaI CCCAGC 1 cut(s) 137
HaeIII GGCC 3 cut(s) 159, 376, 836
Hin1II CATG 6 cut(s) 112, 210, 256, 266, 553, 634
HincII GTYRAC 3 cut(s) 412, 507, 547
HindII GTYRAC 3 cut(s) 412, 507, 547
HinfI GANTC 3 cut(s) 56, 225, 276
HpaI GTTAAC 2 cut(s) 412, 547
HphI GGTGA 2 cut(s) 787, 814
Hpy166II GTNNAC 3 cut(s) 412, 507, 547
Hpy188I TCNGA 4 cut(s) 118, 436, 721, 832
Hpy188III TCNNGA 4 cut(s) 229, 312, 707, 860
Hpy8I GTNNAC 3 cut(s) 412, 507, 547
HpyAV CCTTC 2 cut(s) 258, 535
HpyCH4III ACNGT 1 cut(s) 511
HpyCH4V TGCA 5 cut(s) 185, 206, 272, 392, 428
HpyF10VI GCNNNNNNNGC 2 cut(s) 296, 425
HpyF3I CTNAG 5 cut(s) 117, 144, 161, 465, 831
Hsp92II CATG 6 cut(s) 112, 210, 256, 266, 553, 634
KspAI GTTAAC 2 cut(s) 412, 547
Kzo9I GATC 2 cut(s) 341, 713
LmnI GCTCC 2 cut(s) 91, 853
Lsp1109I GCAGC 2 cut(s) 313, 376
LweI GCATC 2 cut(s) 535, 750
MalI GATC 2 cut(s) 343, 715
MboI GATC 2 cut(s) 341, 713
MboII GAAGA 9 cut(s) 27, 117, 234, 294, 344, 449, 493, 628, 752
MflI RGATCY 2 cut(s) 341, 713
MhlI GDGCHC 2 cut(s) 47, 732
MlsI TGGCCA 1 cut(s) 376
MluCI AATT 3 cut(s) 460, 558, 658
MluNI TGGCCA 1 cut(s) 376
MlyI GAGTC 1 cut(s) 65
MmeI TCCRAC 1 cut(s) 748
Mox20I TGGCCA 1 cut(s) 376
MscI TGGCCA 1 cut(s) 376
MseI TTAA 3 cut(s) 411, 546, 584
MslI CAYNNNNRTG 1 cut(s) 800
Msp20I TGGCCA 1 cut(s) 376
MspA1I CMGCKG 1 cut(s) 137
MspR9I CCNGG 2 cut(s) 167, 416
MvaI CCWGG 2 cut(s) 167, 416
MwoI GCNNNNNNNGC 2 cut(s) 296, 425
NcoI CCATGG 1 cut(s) 252
NdeII GATC 2 cut(s) 341, 713
NlaIII CATG 6 cut(s) 112, 210, 256, 266, 553, 634
NlaIV GGNNCC 1 cut(s) 715
NspI RCATGY 2 cut(s) 112, 634
NspV TTCGAA 1 cut(s) 814
OliI CACNNNNGTG 1 cut(s) 800
PciI ACATGT 1 cut(s) 630
PfeI GAWTC 2 cut(s) 225, 276
PkrI GCNGC 2 cut(s) 328, 391
PleI GAGTC 1 cut(s) 64
PpsI GAGTC 1 cut(s) 64
PpuMI RGGWCCY 1 cut(s) 825
PscI ACATGT 1 cut(s) 630
Psp5II RGGWCCY 1 cut(s) 825
Psp6I CCWGG 2 cut(s) 165, 414
PspFI CCCAGC 1 cut(s) 133
PspGI CCWGG 2 cut(s) 165, 414
PspN4I GGNNCC 1 cut(s) 715
PspPI GGNCC 2 cut(s) 157, 825
PspPPI RGGWCCY 1 cut(s) 825
PsuI RGATCY 2 cut(s) 341, 713
PvuII CAGCTG 1 cut(s) 137
RseI CAYNNNNRTG 1 cut(s) 800
SaqAI TTAA 3 cut(s) 411, 546, 584
SatI GCNGC 2 cut(s) 327, 390
Sau3AI GATC 2 cut(s) 341, 713
Sau96I GGNCC 2 cut(s) 157, 825
SchI GAGTC 1 cut(s) 65
ScrFI CCNGG 2 cut(s) 167, 416
SduI GDGCHC 2 cut(s) 47, 732
SfaNI GCATC 2 cut(s) 535, 750
SfcI CTRYAG 1 cut(s) 564
SfuI TTCGAA 1 cut(s) 814
SinI GGWCC 1 cut(s) 825
SmiI ATTTAAAT 1 cut(s) 585
SmiMI CAYNNNNRTG 1 cut(s) 800
SmlI CTYRAG 2 cut(s) 623, 697
SmoI CTYRAG 2 cut(s) 623, 697
Sse9I AATT 3 cut(s) 460, 558, 658
StyD4I CCNGG 2 cut(s) 165, 414
StyI CCWWGG 2 cut(s) 252, 779
SwaI ATTTAAAT 1 cut(s) 585
TaaI ACNGT 1 cut(s) 511
TaqI TCGA 1 cut(s) 814
TasI AATT 3 cut(s) 460, 558, 658
TfiI GAWTC 2 cut(s) 225, 276
Tru1I TTAA 3 cut(s) 411, 546, 584
Tru9I TTAA 3 cut(s) 411, 546, 584
TscAI CASTG 2 cut(s) 355, 499
TseI GCWGC 2 cut(s) 326, 389
TspDTI ATGAA 3 cut(s) 117, 413, 753
TspGWI ACGGA 2 cut(s) 765, 855
TspRI CASTG 2 cut(s) 355, 499
VpaK11BI GGWCC 1 cut(s) 825
XapI RAATTY 1 cut(s) 558
XceI RCATGY 2 cut(s) 112, 634
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.