Rmu_sc0008365.1_g000004

Belongs to the eukaryotic ribosomal protein eS12 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008365.1
Physical Location & Seq
Forward (+)
31791 .. 33023
1233 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008365.1_g000004.1.cds

Sequence Viewer

Length: 426 bp
atgtcaggtgatgaagcacccgcaccagttgtagctgaagcacctgctccagcccttggcgagcctatggatatcatgacagctgtgcagcttgtgctgagaaaatcgctggctcatggtgggcttgttcgaggtcttcatgaagctgcaaaggttgttgagaagcatgctgcccagctctgtgtcctggccgaggactgtgaccagcaagactatgttaaactagtcaagggtctttgtgctgagcacaacgtaaacatgttgactgttcccaatgccaagaccctaggagagtgggctggtttgtgcaagatcgactccgagggcaaggctaggaaggttgttggttgctcatgtgttgttgtgaaggattttggagaggatcatgaggctctccatgttgttcagcagcatgtcaaggcctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

141

Amino Acids

14.95

Weight (kDa)

5.76

Isoelectric Point (pI)

30.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 52
Acc36I ACCTGC 1 cut(s) 52
AccB7I CCANNNNNTGG 1 cut(s) 56
AciI CCGC 1 cut(s) 21
AclWI GGATC 1 cut(s) 390
AcoI YGGCCR 1 cut(s) 189
AcuI CTGAAG 1 cut(s) 57
AfiI CCNNNNNNNGG 2 cut(s) 56, 193
AflIII ACRYGT 1 cut(s) 258
AhlI ACTAGT 1 cut(s) 223
AjnI CCWGG 1 cut(s) 186
AluBI AGCT 5 cut(s) 35, 83, 91, 146, 178
AluI AGCT 5 cut(s) 35, 83, 91, 146, 178
Alw21I GWGCWC 1 cut(s) 249
AlwI GGATC 1 cut(s) 390
AoxI GGCC 2 cut(s) 189, 420
ApeKI GCWGC 4 cut(s) 88, 146, 170, 409
AspA2I CCTAGG 1 cut(s) 286
AsuHPI GGTGA 1 cut(s) 20
AvrII CCTAGG 1 cut(s) 286
BbsI GAAGAC 1 cut(s) 128
Bbv12I GWGCWC 1 cut(s) 249
BbvI GCAGC 4 cut(s) 100, 133, 157, 421
BciT130I CCWGG 1 cut(s) 188
BcuI ACTAGT 1 cut(s) 223
BfaI CTAG 3 cut(s) 224, 287, 333
BfuAI ACCTGC 1 cut(s) 52
BisI GCNGC 4 cut(s) 89, 147, 171, 410
BlnI CCTAGG 1 cut(s) 286
BlpI GCTNAGC 1 cut(s) 243
BlsI GCNGC 4 cut(s) 90, 148, 172, 411
Bme1390I CCNGG 1 cut(s) 188
BmrFI CCNGG 1 cut(s) 188
BpiI GAAGAC 1 cut(s) 128
BpmI CTGGAG 1 cut(s) 33
Bpu1102I GCTNAGC 1 cut(s) 243
BsaJI CCNNGG 4 cut(s) 55, 192, 286, 321
Bsc4I CCNNNNNNNGG 2 cut(s) 56, 193
Bse1I ACTGG 1 cut(s) 26
BseBI CCWGG 1 cut(s) 188
BseDI CCNNGG 4 cut(s) 55, 192, 286, 321
BseLI CCNNNNNNNGG 2 cut(s) 56, 193
BseMII CTCAG 2 cut(s) 89, 234
BseNI ACTGG 1 cut(s) 26
BseXI GCAGC 4 cut(s) 100, 133, 157, 421
BseYI CCCAGC 1 cut(s) 174
BsgI GTGCAG 1 cut(s) 107
BshFI GGCC 2 cut(s) 191, 422
BsiHKAI GWGCWC 1 cut(s) 249
BslI CCNNNNNNNGG 2 cut(s) 56, 193
BsnI GGCC 2 cut(s) 191, 422
Bsp1286I GDGCHC 1 cut(s) 249
Bsp143I GATC 2 cut(s) 312, 382
Bsp1720I GCTNAGC 1 cut(s) 243
BspACI CCGC 1 cut(s) 21
BspANI GGCC 2 cut(s) 191, 422
BspCNI CTCAG 2 cut(s) 90, 235
BspHI TCATGA 3 cut(s) 75, 139, 385
BspMI ACCTGC 1 cut(s) 52
BspPI GGATC 1 cut(s) 390
BsrI ACTGG 1 cut(s) 26
BssECI CCNNGG 4 cut(s) 55, 192, 286, 321
BssMI GATC 2 cut(s) 312, 382
BssT1I CCWWGG 2 cut(s) 55, 286
Bst2UI CCWGG 1 cut(s) 188
Bst4CI ACNGT 2 cut(s) 200, 268
BstAPI GCANNNNNTGC 1 cut(s) 94
BstC8I GCNNGC 3 cut(s) 62, 111, 168
BstDEI CTNAG 2 cut(s) 98, 243
BstENI CCTNNNNNAGG 1 cut(s) 191
BstKTI GATC 2 cut(s) 315, 385
BstMBI GATC 2 cut(s) 312, 382
BstMWI GCNNNNNNNGC 1 cut(s) 94
BstNI CCWGG 1 cut(s) 188
BstNSI RCATGY 3 cut(s) 170, 262, 416
BstSCI CCNGG 1 cut(s) 186
BstV1I GCAGC 4 cut(s) 100, 133, 157, 421
BstV2I GAAGAC 1 cut(s) 128
BsuRI GGCC 2 cut(s) 191, 422
BveI ACCTGC 1 cut(s) 52
Cac8I GCNNGC 3 cut(s) 62, 111, 168
CciI TCATGA 3 cut(s) 75, 139, 385
CviAII CATG 9 cut(s) 76, 116, 140, 167, 259, 354, 386, 398, 413
DdeI CTNAG 2 cut(s) 98, 243
DpnI GATC 2 cut(s) 314, 384
DpnII GATC 2 cut(s) 312, 382
EaeI YGGCCR 1 cut(s) 189
Eco130I CCWWGG 2 cut(s) 55, 286
Eco147I AGGCCT 1 cut(s) 422
Eco32I GATATC 1 cut(s) 73
Eco57I CTGAAG 1 cut(s) 57
EcoNI CCTNNNNNAGG 1 cut(s) 191
EcoRII CCWGG 1 cut(s) 186
EcoRV GATATC 1 cut(s) 73
EcoT14I CCWWGG 2 cut(s) 55, 286
ErhI CCWWGG 2 cut(s) 55, 286
FaeI CATG 9 cut(s) 79, 119, 143, 170, 262, 357, 389, 401, 416
FatI CATG 9 cut(s) 75, 115, 139, 166, 258, 353, 385, 397, 412
FauI CCCGC 1 cut(s) 28
Fnu4HI GCNGC 4 cut(s) 89, 147, 171, 410
Fsp4HI GCNGC 4 cut(s) 89, 147, 171, 410
FspBI CTAG 3 cut(s) 224, 287, 333
GluI GCNGC 4 cut(s) 89, 147, 171, 410
GsaI CCCAGC 1 cut(s) 178
GsuI CTGGAG 1 cut(s) 33
HaeIII GGCC 2 cut(s) 191, 422
Hin1II CATG 9 cut(s) 79, 119, 143, 170, 262, 357, 389, 401, 416
HincII GTYRAC 1 cut(s) 264
HindII GTYRAC 1 cut(s) 264
HinfI GANTC 1 cut(s) 317
HphI GGTGA 1 cut(s) 20
Hpy166II GTNNAC 2 cut(s) 256, 264
Hpy188I TCNGA 1 cut(s) 322
Hpy188III TCNNGA 3 cut(s) 76, 140, 386
Hpy8I GTNNAC 2 cut(s) 256, 264
HpyAV CCTTC 2 cut(s) 331, 361
HpyCH4III ACNGT 2 cut(s) 200, 268
HpyCH4IV ACGT 1 cut(s) 252
HpyCH4V TGCA 3 cut(s) 88, 149, 309
HpyF10VI GCNNNNNNNGC 1 cut(s) 94
HpyF3I CTNAG 2 cut(s) 98, 243
HpySE526I ACGT 1 cut(s) 252
Hsp92II CATG 9 cut(s) 79, 119, 143, 170, 262, 357, 389, 401, 416
Kzo9I GATC 2 cut(s) 312, 382
LmnI GCTCC 1 cut(s) 52
LpnPI CCDG 9 cut(s) 39, 57, 63, 95, 173, 188, 200, 218, 285
Lsp1109I GCAGC 4 cut(s) 100, 133, 157, 421
MaeI CTAG 3 cut(s) 224, 287, 333
MaeII ACGT 1 cut(s) 252
MaeIII GTNAC 1 cut(s) 200
MalI GATC 2 cut(s) 314, 384
MboI GATC 2 cut(s) 312, 382
MboII GAAGA 1 cut(s) 128
MhlI GDGCHC 1 cut(s) 249
MlyI GAGTC 1 cut(s) 311
MnlI CCTC 5 cut(s) 125, 187, 316, 373, 382
MseI TTAA 1 cut(s) 219
MspA1I CMGCKG 1 cut(s) 83
MspR9I CCNGG 1 cut(s) 188
MvaI CCWGG 1 cut(s) 188
MwoI GCNNNNNNNGC 1 cut(s) 94
NdeII GATC 2 cut(s) 312, 382
NlaIII CATG 9 cut(s) 79, 119, 143, 170, 262, 357, 389, 401, 416
NmeAIII GCCGAG 1 cut(s) 217
NmuCI GTSAC 1 cut(s) 200
NspI RCATGY 3 cut(s) 170, 262, 416
PaeI GCATGC 1 cut(s) 170
PagI TCATGA 3 cut(s) 75, 139, 385
PaqCI CACCTGC 1 cut(s) 52
PceI AGGCCT 1 cut(s) 422
PciI ACATGT 1 cut(s) 258
PflMI CCANNNNNTGG 1 cut(s) 56
PkrI GCNGC 4 cut(s) 90, 148, 172, 411
PleI GAGTC 1 cut(s) 311
PpsI GAGTC 1 cut(s) 311
PscI ACATGT 1 cut(s) 258
Psp6I CCWGG 1 cut(s) 186
PspFI CCCAGC 1 cut(s) 174
PspGI CCWGG 1 cut(s) 186
PvuII CAGCTG 1 cut(s) 83
SaqAI TTAA 1 cut(s) 219
SatI GCNGC 4 cut(s) 89, 147, 171, 410
Sau3AI GATC 2 cut(s) 312, 382
SchI GAGTC 1 cut(s) 311
ScrFI CCNGG 1 cut(s) 188
SduI GDGCHC 1 cut(s) 249
SpeI ACTAGT 1 cut(s) 223
SphI GCATGC 1 cut(s) 170
SseBI AGGCCT 1 cut(s) 422
SsiI CCGC 1 cut(s) 21
SspMI CTAG 3 cut(s) 224, 287, 333
StuI AGGCCT 1 cut(s) 422
StyD4I CCNGG 1 cut(s) 186
StyI CCWWGG 2 cut(s) 55, 286
TaaI ACNGT 2 cut(s) 200, 268
TaiI ACGT 1 cut(s) 255
TaqI TCGA 2 cut(s) 130, 315
Tru1I TTAA 1 cut(s) 219
Tru9I TTAA 1 cut(s) 219
TseFI GTSAC 1 cut(s) 200
TseI GCWGC 4 cut(s) 88, 146, 170, 409
Tsp45I GTSAC 1 cut(s) 200
TspDTI ATGAA 3 cut(s) 27, 128, 156
Van91I CCANNNNNTGG 1 cut(s) 56
XagI CCTNNNNNAGG 1 cut(s) 191
XceI RCATGY 3 cut(s) 170, 262, 416
XmaJI CCTAGG 1 cut(s) 286
XspI CTAG 3 cut(s) 224, 287, 333
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.