Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008365.1

Orthogroup ID

OG0002614

Physical Location & Seq

Genomic Coordinates Forward (+)

31791 .. 33023

Gene Structure 1233 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008365.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 426 bp

atgtcaggtgatgaagcacccgcaccagttgtagctgaagcacctgctccagcccttggcgagcctatggatatcatgacagctgtgcagcttgtgctgagaaaatcgctggctcatggtgggcttgttcgaggtcttcatgaagctgcaaaggttgttgagaagcatgctgcccagctctgtgtcctggccgaggactgtgaccagcaagactatgttaaactagtcaagggtctttgtgctgagcacaacgtaaacatgttgactgttcccaatgccaagaccctaggagagtgggctggtttgtgcaagatcgactccgagggcaaggctaggaaggttgttggttgctcatgtgttgttgtgaaggattttggagaggatcatgaggctctccatgttgttcagcagcatgtcaaggcctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_L7Ae

Protein Analysis

141

Amino Acids

14.95

Weight (kDa)

5.76

Isoelectric Point (pI)

30.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002614)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G15930 AT1G15930 AT2G32060 AT2G32060 AT2G32060
fragaria_vesca	FvH4_1g01120 FvH4_1g01120 FvH4_1g01120 FvH4_1g01140 FvH4_6g28730
malus_domestica	MD02G1009400.v1.1 MD02G1009500.v1.1 MD15G1154900.v1.1 MD15G1155000.v1.1
prunus_persica	Prupe.3G097200_v2.0.a1 Prupe.7G260600_v2.0.a1 Prupe.7G260600_v2.0.a1 Prupe.7G260600_v2.0.a1
pyrus_communis	pycom02g00840 pycom15g13840 pycom15g13850
rosa_chinensis	RchiOBHm_Chr2g0085931 RchiOBHm_Chr2g0133131
rosa_laevigata	RLG00000019310
rosa_multiflora	Rmu_sc0000127.1_g000001 Rmu_sc0001748.1_g000002 Rmu_sc0008365.1_g000004 Rmu_sc0026593.1_g000005 Rmu_ssc0000355.1_g000029
rosa_roxburghii	Rroxscaffold_2G00111370 Rroxscaffold_2G00154920
rosa_rugosa	Rorug01G0464400 Rorug02G0310300
rosa_samantha	Rh2AG013400 Rh2AG362400 Rh2CG014600 Rh2CG345600 Rh2DG385200
rosa_wichuraiana	Rw2G001200 Rw2G029470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	52
Acc36I	ACCTGC	1 cut(s)	52
AccB7I	CCANNNNNTGG	1 cut(s)	56
AciI	CCGC	1 cut(s)	21
AclWI	GGATC	1 cut(s)	390
AcoI	YGGCCR	1 cut(s)	189
AcuI	CTGAAG	1 cut(s)	57
AfiI	CCNNNNNNNGG	2 cut(s)	56, 193
AflIII	ACRYGT	1 cut(s)	258
AhlI	ACTAGT	1 cut(s)	223
AjnI	CCWGG	1 cut(s)	186
AluBI	AGCT	5 cut(s)	35, 83, 91, 146, 178
AluI	AGCT	5 cut(s)	35, 83, 91, 146, 178
Alw21I	GWGCWC	1 cut(s)	249
AlwI	GGATC	1 cut(s)	390
AoxI	GGCC	2 cut(s)	189, 420
ApeKI	GCWGC	4 cut(s)	88, 146, 170, 409
AspA2I	CCTAGG	1 cut(s)	286
AsuHPI	GGTGA	1 cut(s)	20
AvrII	CCTAGG	1 cut(s)	286
BbsI	GAAGAC	1 cut(s)	128
Bbv12I	GWGCWC	1 cut(s)	249
BbvI	GCAGC	4 cut(s)	100, 133, 157, 421
BciT130I	CCWGG	1 cut(s)	188
BcuI	ACTAGT	1 cut(s)	223
BfaI	CTAG	3 cut(s)	224, 287, 333
BfuAI	ACCTGC	1 cut(s)	52
BisI	GCNGC	4 cut(s)	89, 147, 171, 410
BlnI	CCTAGG	1 cut(s)	286
BlpI	GCTNAGC	1 cut(s)	243
BlsI	GCNGC	4 cut(s)	90, 148, 172, 411
Bme1390I	CCNGG	1 cut(s)	188
BmrFI	CCNGG	1 cut(s)	188
BpiI	GAAGAC	1 cut(s)	128
BpmI	CTGGAG	1 cut(s)	33
Bpu1102I	GCTNAGC	1 cut(s)	243
BsaJI	CCNNGG	4 cut(s)	55, 192, 286, 321
Bsc4I	CCNNNNNNNGG	2 cut(s)	56, 193
Bse1I	ACTGG	1 cut(s)	26
BseBI	CCWGG	1 cut(s)	188
BseDI	CCNNGG	4 cut(s)	55, 192, 286, 321
BseLI	CCNNNNNNNGG	2 cut(s)	56, 193
BseMII	CTCAG	2 cut(s)	89, 234
BseNI	ACTGG	1 cut(s)	26
BseXI	GCAGC	4 cut(s)	100, 133, 157, 421
BseYI	CCCAGC	1 cut(s)	174
BsgI	GTGCAG	1 cut(s)	107
BshFI	GGCC	2 cut(s)	191, 422
BsiHKAI	GWGCWC	1 cut(s)	249
BslI	CCNNNNNNNGG	2 cut(s)	56, 193
BsnI	GGCC	2 cut(s)	191, 422
Bsp1286I	GDGCHC	1 cut(s)	249
Bsp143I	GATC	2 cut(s)	312, 382
Bsp1720I	GCTNAGC	1 cut(s)	243
BspACI	CCGC	1 cut(s)	21
BspANI	GGCC	2 cut(s)	191, 422
BspCNI	CTCAG	2 cut(s)	90, 235
BspHI	TCATGA	3 cut(s)	75, 139, 385
BspMI	ACCTGC	1 cut(s)	52
BspPI	GGATC	1 cut(s)	390
BsrI	ACTGG	1 cut(s)	26
BssECI	CCNNGG	4 cut(s)	55, 192, 286, 321
BssMI	GATC	2 cut(s)	312, 382
BssT1I	CCWWGG	2 cut(s)	55, 286
Bst2UI	CCWGG	1 cut(s)	188
Bst4CI	ACNGT	2 cut(s)	200, 268
BstAPI	GCANNNNNTGC	1 cut(s)	94
BstC8I	GCNNGC	3 cut(s)	62, 111, 168
BstDEI	CTNAG	2 cut(s)	98, 243
BstENI	CCTNNNNNAGG	1 cut(s)	191
BstKTI	GATC	2 cut(s)	315, 385
BstMBI	GATC	2 cut(s)	312, 382
BstMWI	GCNNNNNNNGC	1 cut(s)	94
BstNI	CCWGG	1 cut(s)	188
BstNSI	RCATGY	3 cut(s)	170, 262, 416
BstSCI	CCNGG	1 cut(s)	186
BstV1I	GCAGC	4 cut(s)	100, 133, 157, 421
BstV2I	GAAGAC	1 cut(s)	128
BsuRI	GGCC	2 cut(s)	191, 422
BveI	ACCTGC	1 cut(s)	52
Cac8I	GCNNGC	3 cut(s)	62, 111, 168
CciI	TCATGA	3 cut(s)	75, 139, 385
CviAII	CATG	9 cut(s)	76, 116, 140, 167, 259, 354, 386, 398, 413
DdeI	CTNAG	2 cut(s)	98, 243
DpnI	GATC	2 cut(s)	314, 384
DpnII	GATC	2 cut(s)	312, 382
EaeI	YGGCCR	1 cut(s)	189
Eco130I	CCWWGG	2 cut(s)	55, 286
Eco147I	AGGCCT	1 cut(s)	422
Eco32I	GATATC	1 cut(s)	73
Eco57I	CTGAAG	1 cut(s)	57
EcoNI	CCTNNNNNAGG	1 cut(s)	191
EcoRII	CCWGG	1 cut(s)	186
EcoRV	GATATC	1 cut(s)	73
EcoT14I	CCWWGG	2 cut(s)	55, 286
ErhI	CCWWGG	2 cut(s)	55, 286
FaeI	CATG	9 cut(s)	79, 119, 143, 170, 262, 357, 389, 401, 416
FatI	CATG	9 cut(s)	75, 115, 139, 166, 258, 353, 385, 397, 412
FauI	CCCGC	1 cut(s)	28
Fnu4HI	GCNGC	4 cut(s)	89, 147, 171, 410
Fsp4HI	GCNGC	4 cut(s)	89, 147, 171, 410
FspBI	CTAG	3 cut(s)	224, 287, 333
GluI	GCNGC	4 cut(s)	89, 147, 171, 410
GsaI	CCCAGC	1 cut(s)	178
GsuI	CTGGAG	1 cut(s)	33
HaeIII	GGCC	2 cut(s)	191, 422
Hin1II	CATG	9 cut(s)	79, 119, 143, 170, 262, 357, 389, 401, 416
HincII	GTYRAC	1 cut(s)	264
HindII	GTYRAC	1 cut(s)	264
HinfI	GANTC	1 cut(s)	317
HphI	GGTGA	1 cut(s)	20
Hpy166II	GTNNAC	2 cut(s)	256, 264
Hpy188I	TCNGA	1 cut(s)	322
Hpy188III	TCNNGA	3 cut(s)	76, 140, 386
Hpy8I	GTNNAC	2 cut(s)	256, 264
HpyAV	CCTTC	2 cut(s)	331, 361
HpyCH4III	ACNGT	2 cut(s)	200, 268
HpyCH4IV	ACGT	1 cut(s)	252
HpyCH4V	TGCA	3 cut(s)	88, 149, 309
HpyF10VI	GCNNNNNNNGC	1 cut(s)	94
HpyF3I	CTNAG	2 cut(s)	98, 243
HpySE526I	ACGT	1 cut(s)	252
Hsp92II	CATG	9 cut(s)	79, 119, 143, 170, 262, 357, 389, 401, 416
Kzo9I	GATC	2 cut(s)	312, 382
LmnI	GCTCC	1 cut(s)	52
LpnPI	CCDG	9 cut(s)	39, 57, 63, 95, 173, 188, 200, 218, 285
Lsp1109I	GCAGC	4 cut(s)	100, 133, 157, 421
MaeI	CTAG	3 cut(s)	224, 287, 333
MaeII	ACGT	1 cut(s)	252
MaeIII	GTNAC	1 cut(s)	200
MalI	GATC	2 cut(s)	314, 384
MboI	GATC	2 cut(s)	312, 382
MboII	GAAGA	1 cut(s)	128
MhlI	GDGCHC	1 cut(s)	249
MlyI	GAGTC	1 cut(s)	311
MnlI	CCTC	5 cut(s)	125, 187, 316, 373, 382
MseI	TTAA	1 cut(s)	219
MspA1I	CMGCKG	1 cut(s)	83
MspR9I	CCNGG	1 cut(s)	188
MvaI	CCWGG	1 cut(s)	188
MwoI	GCNNNNNNNGC	1 cut(s)	94
NdeII	GATC	2 cut(s)	312, 382
NlaIII	CATG	9 cut(s)	79, 119, 143, 170, 262, 357, 389, 401, 416
NmeAIII	GCCGAG	1 cut(s)	217
NmuCI	GTSAC	1 cut(s)	200
NspI	RCATGY	3 cut(s)	170, 262, 416
PaeI	GCATGC	1 cut(s)	170
PagI	TCATGA	3 cut(s)	75, 139, 385
PaqCI	CACCTGC	1 cut(s)	52
PceI	AGGCCT	1 cut(s)	422
PciI	ACATGT	1 cut(s)	258
PflMI	CCANNNNNTGG	1 cut(s)	56
PkrI	GCNGC	4 cut(s)	90, 148, 172, 411
PleI	GAGTC	1 cut(s)	311
PpsI	GAGTC	1 cut(s)	311
PscI	ACATGT	1 cut(s)	258
Psp6I	CCWGG	1 cut(s)	186
PspFI	CCCAGC	1 cut(s)	174
PspGI	CCWGG	1 cut(s)	186
PvuII	CAGCTG	1 cut(s)	83
SaqAI	TTAA	1 cut(s)	219
SatI	GCNGC	4 cut(s)	89, 147, 171, 410
Sau3AI	GATC	2 cut(s)	312, 382
SchI	GAGTC	1 cut(s)	311
ScrFI	CCNGG	1 cut(s)	188
SduI	GDGCHC	1 cut(s)	249
SpeI	ACTAGT	1 cut(s)	223
SphI	GCATGC	1 cut(s)	170
SseBI	AGGCCT	1 cut(s)	422
SsiI	CCGC	1 cut(s)	21
SspMI	CTAG	3 cut(s)	224, 287, 333
StuI	AGGCCT	1 cut(s)	422
StyD4I	CCNGG	1 cut(s)	186
StyI	CCWWGG	2 cut(s)	55, 286
TaaI	ACNGT	2 cut(s)	200, 268
TaiI	ACGT	1 cut(s)	255
TaqI	TCGA	2 cut(s)	130, 315
Tru1I	TTAA	1 cut(s)	219
Tru9I	TTAA	1 cut(s)	219
TseFI	GTSAC	1 cut(s)	200
TseI	GCWGC	4 cut(s)	88, 146, 170, 409
Tsp45I	GTSAC	1 cut(s)	200
TspDTI	ATGAA	3 cut(s)	27, 128, 156
Van91I	CCANNNNNTGG	1 cut(s)	56
XagI	CCTNNNNNAGG	1 cut(s)	191
XceI	RCATGY	3 cut(s)	170, 262, 416
XmaJI	CCTAGG	1 cut(s)	286
XspI	CTAG	3 cut(s)	224, 287, 333

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.