Rmu_sc0026593.1_g000005

40S ribosomal protein S12-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0026593.1
Physical Location & Seq
Forward (+)
18217 .. 18651
435 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0026593.1_g000005.1.cds

Sequence Viewer

Length: 435 bp
atgtcaggagatgaagttgaggttcccgttcctgttgagcctgtagctgctgctccagctctaggtgagcccatggacctcatgacagcattgcaacttgtgcttaggaagtcattggctcatggtgggcttacacggggcctgcatgaagctgccaaggtcattgagaagcatgctgcacagctttgtgttttggctgaggactgcgaccaggctgattatgttaagctggtgaagtcactgtgtgcagagcataatgttaacctaatgacaattcctagtgctaaaactcttggagaatggtctgggctttgcaagattgattctgaagggaaggcaagaaaggtcgttggttgctcttgcgttgttgtcaaggattttggtgaagatacagaaggccttcatgttgttcaggagtacgtgaagtcccattaa

Protein Analysis

144

Amino Acids

15.37

Weight (kDa)

5.3

Isoelectric Point (pI)

33.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 348
AdeI CACNNNGTG 1 cut(s) 245
AfaI GTAC 1 cut(s) 419
AfiI CCNNNNNNNGG 1 cut(s) 62
AjnI CCWGG 1 cut(s) 210
AluBI AGCT 5 cut(s) 47, 59, 152, 184, 229
AluI AGCT 5 cut(s) 47, 59, 152, 184, 229
AoxI GGCC 2 cut(s) 139, 397
ApeKI GCWGC 4 cut(s) 47, 50, 152, 176
Asp700I GAANNNNTTC 1 cut(s) 399
AspS9I GGNCC 2 cut(s) 76, 139
AsuHPI GGTGA 3 cut(s) 77, 244, 395
AvaII GGWCC 1 cut(s) 76
BanII GRGCYC 1 cut(s) 72
BbvCI CCTCAGC 1 cut(s) 198
BbvI GCAGC 4 cut(s) 34, 37, 139, 163
BciT130I CCWGG 1 cut(s) 212
BfaI CTAG 2 cut(s) 62, 279
BfmI CTRYAG 1 cut(s) 42
BisI GCNGC 4 cut(s) 48, 51, 153, 177
BlsI GCNGC 4 cut(s) 49, 52, 154, 178
Bme1390I CCNGG 1 cut(s) 212
Bme18I GGWCC 1 cut(s) 76
BmgT120I GGNCC 2 cut(s) 76, 139
BmiI GGNNCC 2 cut(s) 24, 140
BmrFI CCNGG 1 cut(s) 212
BpmI CTGGAG 1 cut(s) 39
Bpu10I CCTNAGC 2 cut(s) 104, 198
BsaAI YACGTR 1 cut(s) 421
BsaJI CCNNGG 2 cut(s) 72, 156
BsaXI ACNNNNNCTCC 1 cut(s) 30
Bsc4I CCNNNNNNNGG 1 cut(s) 62
Bse3DI GCAATG 1 cut(s) 89
BseBI CCWGG 1 cut(s) 212
BseDI CCNNGG 2 cut(s) 72, 156
BseLI CCNNNNNNNGG 1 cut(s) 62
BseMI GCAATG 1 cut(s) 89
BseMII CTCAG 1 cut(s) 189
BseXI GCAGC 4 cut(s) 34, 37, 139, 163
BsgI GTGCAG 2 cut(s) 162, 267
BshFI GGCC 2 cut(s) 141, 399
BslFI GGGAC 1 cut(s) 412
BslI CCNNNNNNNGG 1 cut(s) 62
BsmFI GGGAC 1 cut(s) 412
BsnI GGCC 2 cut(s) 141, 399
Bsp1286I GDGCHC 1 cut(s) 72
Bsp19I CCATGG 1 cut(s) 72
BspANI GGCC 2 cut(s) 141, 399
BspCNI CTCAG 1 cut(s) 190
BspHI TCATGA 1 cut(s) 81
BspLI GGNNCC 2 cut(s) 24, 140
BsrDI GCAATG 1 cut(s) 89
BssECI CCNNGG 2 cut(s) 72, 156
BssT1I CCWWGG 2 cut(s) 72, 156
Bst2UI CCWGG 1 cut(s) 212
Bst4CI ACNGT 1 cut(s) 243
BstAPI GCANNNNNTGC 1 cut(s) 100
BstBAI YACGTR 1 cut(s) 421
BstC8I GCNNGC 2 cut(s) 143, 174
BstDEI CTNAG 2 cut(s) 104, 198
BstDSI CCRYGG 1 cut(s) 72
BstMWI GCNNNNNNNGC 2 cut(s) 56, 100
BstNI CCWGG 1 cut(s) 212
BstNSI RCATGY 1 cut(s) 176
BstSCI CCNGG 1 cut(s) 210
BstSFI CTRYAG 1 cut(s) 42
BstV1I GCAGC 4 cut(s) 34, 37, 139, 163
BsuRI GGCC 2 cut(s) 141, 399
BtgI CCRYGG 1 cut(s) 72
BtsIMutI CAGTG 1 cut(s) 239
Cac8I GCNNGC 2 cut(s) 143, 174
CciI TCATGA 1 cut(s) 81
Cfr13I GGNCC 2 cut(s) 76, 139
Csp6I GTAC 1 cut(s) 418
CviAII CATG 6 cut(s) 73, 82, 122, 146, 173, 404
CviQI GTAC 1 cut(s) 418
DdeI CTNAG 2 cut(s) 104, 198
DraIII CACNNNGTG 1 cut(s) 245
Eco130I CCWWGG 2 cut(s) 72, 156
Eco147I AGGCCT 1 cut(s) 399
Eco24I GRGCYC 1 cut(s) 72
Eco47I GGWCC 1 cut(s) 76
Eco57I CTGAAG 1 cut(s) 348
EcoO109I RGGNCCY 1 cut(s) 139
EcoRII CCWGG 1 cut(s) 210
EcoT14I CCWWGG 2 cut(s) 72, 156
EcoT38I GRGCYC 1 cut(s) 72
ErhI CCWWGG 2 cut(s) 72, 156
FaeI CATG 6 cut(s) 76, 85, 125, 149, 176, 407
FaiI YATR 8 cut(s) 74, 83, 123, 147, 174, 222, 255, 405
FaqI GGGAC 1 cut(s) 412
FatI CATG 6 cut(s) 72, 81, 121, 145, 172, 403
Fnu4HI GCNGC 4 cut(s) 48, 51, 153, 177
FriOI GRGCYC 1 cut(s) 72
Fsp4HI GCNGC 4 cut(s) 48, 51, 153, 177
FspBI CTAG 2 cut(s) 62, 279
GluI GCNGC 4 cut(s) 48, 51, 153, 177
GsuI CTGGAG 1 cut(s) 39
HaeIII GGCC 2 cut(s) 141, 399
Hin1II CATG 6 cut(s) 76, 85, 125, 149, 176, 407
HincII GTYRAC 1 cut(s) 262
HindII GTYRAC 1 cut(s) 262
HinfI GANTC 1 cut(s) 323
HpaI GTTAAC 1 cut(s) 262
HphI GGTGA 3 cut(s) 77, 244, 395
Hpy166II GTNNAC 1 cut(s) 262
Hpy188I TCNGA 1 cut(s) 328
Hpy188III TCNNGA 3 cut(s) 6, 82, 413
Hpy8I GTNNAC 1 cut(s) 262
HpyAV CCTTC 4 cut(s) 323, 328, 389, 410
HpyCH4III ACNGT 1 cut(s) 243
HpyCH4IV ACGT 1 cut(s) 420
HpyCH4V TGCA 5 cut(s) 94, 145, 179, 248, 315
HpyF10VI GCNNNNNNNGC 2 cut(s) 56, 100
HpyF3I CTNAG 2 cut(s) 104, 198
HpySE526I ACGT 1 cut(s) 420
Hsp92II CATG 6 cut(s) 76, 85, 125, 149, 176, 407
KspAI GTTAAC 1 cut(s) 262
LmnI GCTCC 1 cut(s) 58
LpnPI CCDG 9 cut(s) 45, 54, 69, 155, 197, 215, 224, 291, 398
Lsp1109I GCAGC 4 cut(s) 34, 37, 139, 163
MaeI CTAG 2 cut(s) 62, 279
MaeII ACGT 1 cut(s) 420
MaeIII GTNAC 1 cut(s) 237
MboII GAAGA 1 cut(s) 398
MhlI GDGCHC 1 cut(s) 72
MluCI AATT 1 cut(s) 273
MnlI CCTC 3 cut(s) 13, 89, 193
MroXI GAANNNNTTC 1 cut(s) 399
MseI TTAA 3 cut(s) 225, 261, 433
MspR9I CCNGG 1 cut(s) 212
MvaI CCWGG 1 cut(s) 212
MwoI GCNNNNNNNGC 2 cut(s) 56, 100
NcoI CCATGG 1 cut(s) 72
NlaIII CATG 6 cut(s) 76, 85, 125, 149, 176, 407
NlaIV GGNNCC 2 cut(s) 24, 140
NmuCI GTSAC 1 cut(s) 237
NspI RCATGY 1 cut(s) 176
PaeI GCATGC 1 cut(s) 176
PagI TCATGA 1 cut(s) 81
PceI AGGCCT 1 cut(s) 399
PdmI GAANNNNTTC 1 cut(s) 399
PfeI GAWTC 1 cut(s) 323
PkrI GCNGC 4 cut(s) 49, 52, 154, 178
Ppu21I YACGTR 1 cut(s) 421
Psp6I CCWGG 1 cut(s) 210
PspGI CCWGG 1 cut(s) 210
PspN4I GGNNCC 2 cut(s) 24, 140
PspPI GGNCC 2 cut(s) 76, 139
RsaI GTAC 1 cut(s) 419
RsaNI GTAC 1 cut(s) 418
SaqAI TTAA 3 cut(s) 225, 261, 433
SatI GCNGC 4 cut(s) 48, 51, 153, 177
Sau96I GGNCC 2 cut(s) 76, 139
ScrFI CCNGG 1 cut(s) 212
SduI GDGCHC 1 cut(s) 72
SfcI CTRYAG 1 cut(s) 42
SinI GGWCC 1 cut(s) 76
SphI GCATGC 1 cut(s) 176
Sse9I AATT 1 cut(s) 273
SseBI AGGCCT 1 cut(s) 399
SspMI CTAG 2 cut(s) 62, 279
StuI AGGCCT 1 cut(s) 399
StyD4I CCNGG 1 cut(s) 210
StyI CCWWGG 2 cut(s) 72, 156
TaaI ACNGT 1 cut(s) 243
TaiI ACGT 1 cut(s) 423
TasI AATT 1 cut(s) 273
TfiI GAWTC 1 cut(s) 323
Tru1I TTAA 3 cut(s) 225, 261, 433
Tru9I TTAA 3 cut(s) 225, 261, 433
TscAI CASTG 1 cut(s) 246
TseFI GTSAC 1 cut(s) 237
TseI GCWGC 4 cut(s) 47, 50, 152, 176
Tsp45I GTSAC 1 cut(s) 237
TspDTI ATGAA 3 cut(s) 27, 162, 392
TspRI CASTG 1 cut(s) 246
VpaK11BI GGWCC 1 cut(s) 76
XceI RCATGY 1 cut(s) 176
XmnI GAANNNNTTC 1 cut(s) 399
XspI CTAG 2 cut(s) 62, 279
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.