Rmu_sc0008955.1_g000004

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008955.1
Physical Location & Seq
Reverse (-)
9457 .. 9825
369 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008955.1_g000004.1.cds

Sequence Viewer

Length: 369 bp
atggtggttgatgcgtatgagctgttgaaggagctgaggaggaagggttgtgagtccaatgcaggttcgtatacgactatgattcaggtacttggcaggcaggagaagatggaggaggcgctgagggtgtttgtggagatggagaggagtggttgtgaggttgatgttgtgacttctactttgattagtggattttgtaagtgggggaagattgtgaggagttatgagattttggagagtataataaggaaagggtttacgctgagtcaaatgacttacttgcaaattatgttggctcatgagaagaaggaagacttggaggagtgtataattgatgaggcaggtgaggaagattggttgcatgcctga

Protein Analysis

122

Amino Acids

14.06

Weight (kDa)

4.82

Isoelectric Point (pI)

44.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 332
Acc36I ACCTGC 2 cut(s) 53, 332
AccI GTMKAC 1 cut(s) 71
AfaI GTAC 1 cut(s) 90
AgsI TTSAA 1 cut(s) 28
AjuI GAANNNNNNNTTGG 2 cut(s) 299, 331
AluBI AGCT 2 cut(s) 22, 34
AluI AGCT 2 cut(s) 22, 34
ArsI GACNNNNNNTTYG 2 cut(s) 163, 195
AspLEI GCGC 1 cut(s) 121
AsuHPI GGTGA 1 cut(s) 356
BbsI GAAGAC 1 cut(s) 318
BbvCI CCTCAGC 2 cut(s) 35, 122
BccI CCATC 2 cut(s) 103, 133
BfoI RGCGCY 1 cut(s) 122
BfuAI ACCTGC 2 cut(s) 53, 332
BpiI GAAGAC 1 cut(s) 318
Bpu10I CCTNAGC 2 cut(s) 35, 122
BsaXI ACNNNNNCTCC 4 cut(s) 31, 61, 139, 169
BseMII CTCAG 3 cut(s) 26, 113, 254
BseRI GAGGAG 5 cut(s) 52, 128, 160, 232, 335
BspCNI CTCAG 3 cut(s) 27, 114, 255
BspHI TCATGA 1 cut(s) 298
BspMI ACCTGC 2 cut(s) 53, 332
BssNAI GTATAC 1 cut(s) 72
Bst1107I GTATAC 1 cut(s) 72
BstC8I GCNNGC 2 cut(s) 98, 363
BstDEI CTNAG 3 cut(s) 35, 122, 263
BstH2I RGCGCY 1 cut(s) 122
BstHHI GCGC 1 cut(s) 121
BstNSI RCATGY 1 cut(s) 365
BstV2I GAAGAC 1 cut(s) 318
BstZ17I GTATAC 1 cut(s) 72
BveI ACCTGC 2 cut(s) 53, 332
Cac8I GCNNGC 2 cut(s) 98, 363
CciI TCATGA 1 cut(s) 298
CfoI GCGC 1 cut(s) 121
Csp6I GTAC 1 cut(s) 89
CviAII CATG 2 cut(s) 299, 362
CviJI RGCY 3 cut(s) 22, 34, 296
CviKI_1 RGCY 3 cut(s) 22, 34, 296
CviQI GTAC 1 cut(s) 89
DdeI CTNAG 3 cut(s) 35, 122, 263
FaeI CATG 2 cut(s) 302, 365
FaiI YATR 9 cut(s) 18, 72, 80, 225, 242, 290, 300, 329, 363
FalI AAGNNNNNCTT 2 cut(s) 299, 331
FatI CATG 2 cut(s) 298, 361
FblI GTMKAC 1 cut(s) 71
GlaI GCGC 1 cut(s) 120
HaeII RGCGCY 1 cut(s) 122
HhaI GCGC 1 cut(s) 121
Hin1II CATG 2 cut(s) 302, 365
Hin6I GCGC 1 cut(s) 119
HinP1I GCGC 1 cut(s) 119
HinfI GANTC 3 cut(s) 53, 82, 265
HphI GGTGA 1 cut(s) 356
Hpy166II GTNNAC 2 cut(s) 72, 258
Hpy188III TCNNGA 1 cut(s) 299
Hpy8I GTNNAC 2 cut(s) 72, 258
HpyAV CCTTC 3 cut(s) 22, 37, 301
HpyCH4V TGCA 3 cut(s) 62, 283, 361
HpyF3I CTNAG 3 cut(s) 35, 122, 263
Hsp92II CATG 2 cut(s) 302, 365
HspAI GCGC 1 cut(s) 119
LmnI GCTCC 1 cut(s) 31
LpnPI CCDG 5 cut(s) 48, 71, 82, 86, 327
MaeIII GTNAC 1 cut(s) 169
MboII GAAGA 5 cut(s) 118, 220, 316, 323, 362
MluCI AATT 2 cut(s) 285, 330
MlyI GAGTC 2 cut(s) 62, 274
NlaIII CATG 2 cut(s) 302, 365
NmuCI GTSAC 1 cut(s) 169
NspI RCATGY 1 cut(s) 365
PaeI GCATGC 1 cut(s) 365
PagI TCATGA 1 cut(s) 298
PaqCI CACCTGC 1 cut(s) 332
PfeI GAWTC 1 cut(s) 82
PleI GAGTC 2 cut(s) 61, 273
PpsI GAGTC 2 cut(s) 61, 273
RsaI GTAC 1 cut(s) 90
RsaNI GTAC 1 cut(s) 89
SchI GAGTC 2 cut(s) 62, 274
SetI ASST 6 cut(s) 24, 36, 67, 90, 162, 346
SgeI CNNG 9 cut(s) 75, 98, 104, 109, 113, 292, 311, 328, 354
SphI GCATGC 1 cut(s) 365
Sse9I AATT 2 cut(s) 285, 330
TasI AATT 2 cut(s) 285, 330
TfiI GAWTC 1 cut(s) 82
TseFI GTSAC 1 cut(s) 169
Tsp45I GTSAC 1 cut(s) 169
XceI RCATGY 1 cut(s) 365
XmiI GTMKAC 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.