Rmu_sc0026245.1_g000002

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0026245.1
Physical Location & Seq
Reverse (-)
3871 .. 4263
393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0026245.1_g000002.1.cds

Sequence Viewer

Length: 393 bp
atggagaggaatgggtgtctgccgaatgtggttacgtataatacgttgattgatgcttattgtaagttgaagaggatggatgacgcgttcggattgttgagatcgatggcattgaagggtttggagcctaatttgatttcctataatgtggtgattaatgggttgtgtcgagaagggaggatgaatgagactggtcagattcttgaggagatgaaaaggaagggttttgttcctgacgaggtgacgaataatacactcattagtgggtattgcaaggaaggtaattttcaccaagcacttgtgttgcaagaggagatgcggaggatggcttgtctccgcatgttgtcacttatacagcatttatcaatgccatgtgtaaggctaggaatttga

Protein Analysis

130

Amino Acids

14.8

Weight (kDa)

8.24

Isoelectric Point (pI)

37.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 86
AciI CCGC 2 cut(s) 319, 337
AcsI RAATTY 1 cut(s) 387
AflIII ACRYGT 1 cut(s) 84
AgsI TTSAA 2 cut(s) 70, 115
AloI GAACNNNNNNTCC 2 cut(s) 71, 103
Alw26I GTCTC 2 cut(s) 182, 338
ApoI RAATTY 1 cut(s) 387
AseI ATTAAT 1 cut(s) 156
AsuHPI GGTGA 3 cut(s) 163, 253, 281
BccI CCATC 3 cut(s) 70, 100, 319
BcoDI GTCTC 2 cut(s) 182, 338
BfaI CTAG 1 cut(s) 383
BmiI GGNNCC 1 cut(s) 126
BmsI GCATC 2 cut(s) 43, 306
BpuEI CTTGAG 1 cut(s) 224
Bsa29I ATCGAT 1 cut(s) 104
BsaAI YACGTR 1 cut(s) 36
Bse1I ACTGG 1 cut(s) 196
BseCI ATCGAT 1 cut(s) 104
BseGI GGATG 4 cut(s) 81, 85, 186, 330
BseNI ACTGG 1 cut(s) 196
BseRI GAGGAG 2 cut(s) 221, 326
Bsh1236I CGCG 1 cut(s) 86
BshVI ATCGAT 1 cut(s) 104
BsmAI GTCTC 2 cut(s) 182, 338
Bsp143I GATC 1 cut(s) 101
BspACI CCGC 2 cut(s) 319, 337
BspDI ATCGAT 1 cut(s) 104
BspFNI CGCG 1 cut(s) 86
BspLI GGNNCC 1 cut(s) 126
BsrI ACTGG 1 cut(s) 196
BssMI GATC 1 cut(s) 101
Bst6I CTCTTC 1 cut(s) 65
BstBAI YACGTR 1 cut(s) 36
BstF5I GGATG 4 cut(s) 81, 85, 186, 330
BstFNI CGCG 1 cut(s) 86
BstKTI GATC 1 cut(s) 104
BstMAI GTCTC 2 cut(s) 182, 338
BstMBI GATC 1 cut(s) 101
BstNSI RCATGY 1 cut(s) 343
BstSNI TACGTA 1 cut(s) 36
BstUI CGCG 1 cut(s) 86
Bsu15I ATCGAT 1 cut(s) 104
BsuTUI ATCGAT 1 cut(s) 104
BtsCI GGATG 4 cut(s) 81, 85, 186, 330
ClaI ATCGAT 1 cut(s) 104
CseI GACGC 1 cut(s) 92
CviAII CATG 2 cut(s) 340, 372
CviJI RGCY 3 cut(s) 127, 329, 382
CviKI_1 RGCY 3 cut(s) 127, 329, 382
DpnI GATC 1 cut(s) 103
DpnII GATC 1 cut(s) 101
Eam1104I CTCTTC 1 cut(s) 65
EarI CTCTTC 1 cut(s) 65
Eco105I TACGTA 1 cut(s) 36
FaeI CATG 2 cut(s) 343, 375
FaiI YATR 5 cut(s) 39, 144, 341, 353, 373
FatI CATG 2 cut(s) 339, 371
FokI GGATG 4 cut(s) 88, 92, 193, 337
FspBI CTAG 1 cut(s) 383
HgaI GACGC 1 cut(s) 92
Hin1II CATG 2 cut(s) 343, 375
HinfI GANTC 1 cut(s) 199
HphI GGTGA 3 cut(s) 163, 253, 281
Hpy188I TCNGA 2 cut(s) 92, 198
Hpy188III TCNNGA 3 cut(s) 170, 203, 233
HpyAV CCTTC 4 cut(s) 109, 167, 214, 272
HpyCH4IV ACGT 2 cut(s) 35, 44
HpyCH4V TGCA 2 cut(s) 273, 307
HpySE526I ACGT 2 cut(s) 35, 44
Hsp92II CATG 2 cut(s) 343, 375
Kzo9I GATC 1 cut(s) 101
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 2 cut(s) 177, 246
LweI GCATC 2 cut(s) 43, 306
MaeI CTAG 1 cut(s) 383
MaeII ACGT 2 cut(s) 35, 44
MaeIII GTNAC 3 cut(s) 31, 241, 345
MalI GATC 1 cut(s) 103
MboI GATC 1 cut(s) 101
MboII GAAGA 1 cut(s) 82
MluCI AATT 3 cut(s) 130, 283, 387
MluI ACGCGT 1 cut(s) 84
MnlI CCTC 6 cut(s) 66, 171, 199, 232, 304, 315
MseI TTAA 1 cut(s) 156
MvnI CGCG 1 cut(s) 86
NdeII GATC 1 cut(s) 101
NlaIII CATG 2 cut(s) 343, 375
NlaIV GGNNCC 1 cut(s) 126
NmuCI GTSAC 2 cut(s) 241, 345
NspI RCATGY 1 cut(s) 343
PcsI WCGNNNNNNNCGW 1 cut(s) 41
PfeI GAWTC 1 cut(s) 199
Ppu21I YACGTR 1 cut(s) 36
PshBI ATTAAT 1 cut(s) 156
PspN4I GGNNCC 1 cut(s) 126
SaqAI TTAA 1 cut(s) 156
Sau3AI GATC 1 cut(s) 101
SetI ASST 4 cut(s) 38, 47, 243, 283
SfaNI GCATC 2 cut(s) 43, 306
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
SnaBI TACGTA 1 cut(s) 36
Sse9I AATT 3 cut(s) 130, 283, 387
SsiI CCGC 2 cut(s) 319, 337
SspMI CTAG 1 cut(s) 383
TaiI ACGT 2 cut(s) 38, 47
TaqI TCGA 2 cut(s) 104, 169
TasI AATT 3 cut(s) 130, 283, 387
TfiI GAWTC 1 cut(s) 199
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TseFI GTSAC 2 cut(s) 241, 345
Tsp45I GTSAC 2 cut(s) 241, 345
TspDTI ATGAA 2 cut(s) 197, 227
VspI ATTAAT 1 cut(s) 156
XapI RAATTY 1 cut(s) 387
XceI RCATGY 1 cut(s) 343
XspI CTAG 1 cut(s) 383
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.