Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0015649.1

Orthogroup ID

OG0003228

Physical Location & Seq

Genomic Coordinates Reverse (-)

34627 .. 35417

Gene Structure 791 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0015649.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 243 bp

atggtgagcttaagaaggcgcaggctcttgggactatgctctgggataagttcttttctaactccacttcctatgttttgtgacaacgcaaaacctgatagcgtgcatcccaggccttcaaaagatagaaatctgctagatgggagtaatggtggaaaaatagaacctctatcatcaacagcatatggttctagcttggcgaaagagcaacctcaaaaatatgttccaggtttgttgctttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AP2

Protein Analysis

80

Amino Acids

8.68

Weight (kDa)

9.69

Isoelectric Point (pI)

62.44

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003228)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G13040 AT4G13040 AT4G13040 AT4G13040 AT4G13040 AT4G13040 AT4G13040 AT4G13040
fragaria_vesca	FvH4_2g18520
malus_domestica	MD05G1171400.v1.1 MD10G1039600.v1.1 MD10G1159600.v1.1
prunus_persica	Prupe.8G198700_v2.0.a1 Prupe.8G198700_v2.0.a1 Prupe.8G198700_v2.0.a1 Prupe.8G198700_v2.0.a1 Prupe.8G198700_v2.0.a1
pyrus_communis	pycom05g15810 pycom10g13780
rosa_chinensis	RchiOBHm_Chr3g0472871 RchiOBHm_Chr6g0284081
rosa_laevigata	RLG00000012771
rosa_multiflora	Rmu_sc0015649.1_g000011
rosa_roxburghii	Rroxscaffold_7G00184950
rosa_rugosa	Rorug04G0064700 Rorug06G0160300 Rorug06G0160400 Rorug06G0160500
rosa_samantha	Rh5BG215100 Rh5BG429800 Rh5CG453400 Rh5DG270800 Rh6AG273300 Rh6BG274000 Rh6CG275400 Rh6DG268400
rosa_wichuraiana	Rw6G023520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AflII	CTTAAG	1 cut(s)	10
AgsI	TTSAA	1 cut(s)	120
AjnI	CCWGG	2 cut(s)	110, 226
AluBI	AGCT	2 cut(s)	9, 195
AluI	AGCT	2 cut(s)	9, 195
AoxI	GGCC	1 cut(s)	113
AspLEI	GCGC	1 cut(s)	21
AsuHPI	GGTGA	1 cut(s)	16
BccI	CCATC	1 cut(s)	134
BciT130I	CCWGG	2 cut(s)	112, 228
BfaI	CTAG	2 cut(s)	137, 192
BfrI	CTTAAG	1 cut(s)	10
Bme1390I	CCNGG	2 cut(s)	112, 228
BmrFI	CCNGG	2 cut(s)	112, 228
BmsI	GCATC	1 cut(s)	115
BsaBI	GATNNNNATC	1 cut(s)	129
BsaJI	CCNNGG	1 cut(s)	110
BsaXI	ACNNNNNCTCC	2 cut(s)	136, 166
Bse8I	GATNNNNATC	1 cut(s)	129
BseBI	CCWGG	2 cut(s)	112, 228
BseDI	CCNNGG	1 cut(s)	110
BseGI	GGATG	1 cut(s)	106
BseJI	GATNNNNATC	1 cut(s)	129
BshFI	GGCC	1 cut(s)	115
BslFI	GGGAC	1 cut(s)	45
BsmFI	GGGAC	1 cut(s)	45
BsnI	GGCC	1 cut(s)	115
BspANI	GGCC	1 cut(s)	115
BspTI	CTTAAG	1 cut(s)	10
BssECI	CCNNGG	1 cut(s)	110
Bst2UI	CCWGG	2 cut(s)	112, 228
BstAFI	CTTAAG	1 cut(s)	10
BstC8I	GCNNGC	2 cut(s)	23, 104
BstF5I	GGATG	1 cut(s)	106
BstHHI	GCGC	1 cut(s)	21
BstMWI	GCNNNNNNNGC	1 cut(s)	112
BstNI	CCWGG	2 cut(s)	112, 228
BstSCI	CCNGG	2 cut(s)	110, 226
BsuRI	GGCC	1 cut(s)	115
BtsCI	GGATG	1 cut(s)	106
Cac8I	GCNNGC	2 cut(s)	23, 104
CfoI	GCGC	1 cut(s)	21
CviJI	RGCY	4 cut(s)	9, 25, 115, 195
CviKI_1	RGCY	4 cut(s)	9, 25, 115, 195
Eco147I	AGGCCT	1 cut(s)	115
EcoRII	CCWGG	2 cut(s)	110, 226
FaiI	YATR	5 cut(s)	37, 74, 184, 186, 222
FaqI	GGGAC	1 cut(s)	45
FauNDI	CATATG	1 cut(s)	184
FokI	GGATG	1 cut(s)	93
FspBI	CTAG	2 cut(s)	137, 192
GlaI	GCGC	1 cut(s)	20
HaeIII	GGCC	1 cut(s)	115
HhaI	GCGC	1 cut(s)	21
Hin6I	GCGC	1 cut(s)	19
HinP1I	GCGC	1 cut(s)	19
HphI	GGTGA	1 cut(s)	16
HpyAV	CCTTC	2 cut(s)	9, 126
HpyCH4V	TGCA	1 cut(s)	106
HpyF10VI	GCNNNNNNNGC	1 cut(s)	112
HspAI	GCGC	1 cut(s)	19
LpnPI	CCDG	6 cut(s)	7, 27, 97, 108, 124, 213
LweI	GCATC	1 cut(s)	115
MaeI	CTAG	2 cut(s)	137, 192
MaeIII	GTNAC	1 cut(s)	80
MnlI	CCTC	2 cut(s)	177, 222
MseI	TTAA	2 cut(s)	11, 241
MspCI	CTTAAG	1 cut(s)	10
MspR9I	CCNGG	2 cut(s)	112, 228
MvaI	CCWGG	2 cut(s)	112, 228
MwoI	GCNNNNNNNGC	1 cut(s)	112
NdeI	CATATG	1 cut(s)	184
NmuCI	GTSAC	1 cut(s)	80
PceI	AGGCCT	1 cut(s)	115
Psp6I	CCWGG	2 cut(s)	110, 226
PspGI	CCWGG	2 cut(s)	110, 226
SaqAI	TTAA	2 cut(s)	11, 241
ScrFI	CCNGG	2 cut(s)	112, 228
SetI	ASST	6 cut(s)	11, 97, 169, 197, 214, 232
SfaNI	GCATC	1 cut(s)	115
SmlI	CTYRAG	1 cut(s)	10
SmoI	CTYRAG	1 cut(s)	10
SseBI	AGGCCT	1 cut(s)	115
SspMI	CTAG	2 cut(s)	137, 192
StuI	AGGCCT	1 cut(s)	115
StyD4I	CCNGG	2 cut(s)	110, 226
Tru1I	TTAA	2 cut(s)	11, 241
Tru9I	TTAA	2 cut(s)	11, 241
TseFI	GTSAC	1 cut(s)	80
Tsp45I	GTSAC	1 cut(s)	80
Vha464I	CTTAAG	1 cut(s)	10
XspI	CTAG	2 cut(s)	137, 192

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.