Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0016199.1

Orthogroup ID

OG0007516

Physical Location & Seq

Genomic Coordinates Reverse (-)

19298 .. 19675

Gene Structure 378 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0016199.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 378 bp

atggttatccgggtctttaccgtgatcttacacagcaaacgaaccgcccccaacgggcccaatgcttacacatacagtgttatcatcaaggctctggctgcagaacctgggtttgtcaagcttgccatgcatgacatgcttgagatgatgacgaagggaattcatcccaatgccaagacctatgttgctgtgttcgaggcctttgctcggaggagggaggaagaagaagaagatgatgataaggtgaaggagtatgtgaaactaatgaaagcaagaggctttaagccggagaaggaggctgtgagggaggttcttacagccacaaatactgaagctgctatggttgaaagggtcctcgatcaactttgtatttggtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_2 PPR_3

Protein Analysis

125

Amino Acids

14.29

Weight (kDa)

6.84

Isoelectric Point (pI)

34.4

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007516)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g06391
rosa_chinensis	RchiOBHm_Chr0c19g0499981 RchiOBHm_Chr2g0121371 RchiOBHm_Chr2g0124851 RchiOBHm_Chr2g0125661 RchiOBHm_Chr2g0131171 RchiOBHm_Chr2g0134161 RchiOBHm_Chr2g0165291 RchiOBHm_Chr3g0462421 RchiOBHm_Chr3g0497621 RchiOBHm_Chr4g0401911 RchiOBHm_Chr5g0067131 RchiOBHm_Chr7g0194981 RchiOBHm_Chr7g0195241 RchiOBHm_Chr7g0200621
rosa_laevigata	RLG00000025358
rosa_multiflora	Rmu_sc0000215.1_g000033 Rmu_sc0010428.1_g000007 Rmu_sc0016199.1_g000006
rosa_roxburghii	Rroxscaffold_5G00343890 Rroxscaffold_5G00387740 Rroxscaffold_6G00424250
rosa_rugosa	Rorug02G0437900
rosa_samantha	Rh3DG069600
rosa_wichuraiana	Rw3G005320

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	45
AcsI	RAATTY	1 cut(s)	159
AcuI	CTGAAG	1 cut(s)	351
AfiI	CCNNNNNNNGG	2 cut(s)	54, 207
AgsI	TTSAA	1 cut(s)	347
AjnI	CCWGG	1 cut(s)	106
AluBI	AGCT	2 cut(s)	121, 335
AluI	AGCT	2 cut(s)	121, 335
AlwNI	CAGNNNCTG	1 cut(s)	107
AoxI	GGCC	2 cut(s)	56, 198
ApaI	GGGCCC	1 cut(s)	60
ApeKI	GCWGC	2 cut(s)	98, 335
ApoI	RAATTY	1 cut(s)	159
AspS9I	GGNCC	3 cut(s)	56, 57, 352
AsuC2I	CCSGG	1 cut(s)	11
AsuHPI	GGTGA	1 cut(s)	256
AvaII	GGWCC	1 cut(s)	352
BaeGI	GKGCMC	1 cut(s)	60
BanII	GRGCYC	1 cut(s)	60
BbvI	GCAGC	2 cut(s)	85, 322
BcgI	CGANNNNNNTGC	2 cut(s)	185, 219
BciT130I	CCWGG	1 cut(s)	108
BcnI	CCSGG	1 cut(s)	11
BfmI	CTRYAG	1 cut(s)	99
BisI	GCNGC	2 cut(s)	99, 336
BlsI	GCNGC	2 cut(s)	100, 337
Bme1390I	CCNGG	2 cut(s)	11, 108
Bme18I	GGWCC	1 cut(s)	352
BmgT120I	GGNCC	3 cut(s)	56, 57, 352
BmiI	GGNNCC	2 cut(s)	58, 353
BmrFI	CCNGG	2 cut(s)	11, 108
BpuEI	CTTGAG	1 cut(s)	161
BpuMI	CCSGG	1 cut(s)	11
BsaJI	CCNNGG	1 cut(s)	107
Bsc4I	CCNNNNNNNGG	2 cut(s)	54, 207
BseBI	CCWGG	1 cut(s)	108
BseDI	CCNNGG	1 cut(s)	107
BseGI	GGATG	1 cut(s)	163
BseLI	CCNNNNNNNGG	2 cut(s)	54, 207
BseRI	GAGGAG	1 cut(s)	226
BseSI	GKGCMC	1 cut(s)	60
BseXI	GCAGC	2 cut(s)	85, 322
BshFI	GGCC	2 cut(s)	58, 200
BsiSI	CCGG	2 cut(s)	10, 287
BslI	CCNNNNNNNGG	2 cut(s)	54, 207
BsnI	GGCC	2 cut(s)	58, 200
Bsp120I	GGGCCC	1 cut(s)	56
Bsp1286I	GDGCHC	1 cut(s)	60
Bsp143I	GATC	2 cut(s)	24, 358
BspACI	CCGC	1 cut(s)	45
BspANI	GGCC	2 cut(s)	58, 200
BspLI	GGNNCC	2 cut(s)	58, 353
BspMAI	CTGCAG	1 cut(s)	103
BssECI	CCNNGG	1 cut(s)	107
BssMI	GATC	2 cut(s)	24, 358
Bst2UI	CCWGG	1 cut(s)	108
Bst4CI	ACNGT	2 cut(s)	22, 77
BstAPI	GCANNNNNTGC	1 cut(s)	136
BstC8I	GCNNGC	1 cut(s)	123
BstF5I	GGATG	1 cut(s)	163
BstKTI	GATC	2 cut(s)	27, 361
BstMBI	GATC	2 cut(s)	24, 358
BstMWI	GCNNNNNNNGC	3 cut(s)	98, 127, 136
BstNI	CCWGG	1 cut(s)	108
BstNSI	RCATGY	1 cut(s)	139
BstSCI	CCNGG	2 cut(s)	9, 106
BstSFI	CTRYAG	1 cut(s)	99
BstSLI	GKGCMC	1 cut(s)	60
BstV1I	GCAGC	2 cut(s)	85, 322
BsuRI	GGCC	2 cut(s)	58, 200
BtsCI	GGATG	1 cut(s)	163
BtsIMutI	CAGTG	1 cut(s)	82
Cac8I	GCNNGC	1 cut(s)	123
CaiI	CAGNNNCTG	1 cut(s)	107
Cfr13I	GGNCC	3 cut(s)	56, 57, 352
CviAII	CATG	3 cut(s)	127, 131, 136
DpnI	GATC	2 cut(s)	26, 360
DpnII	GATC	2 cut(s)	24, 358
Eco147I	AGGCCT	1 cut(s)	200
Eco24I	GRGCYC	1 cut(s)	60
Eco47I	GGWCC	1 cut(s)	352
Eco57I	CTGAAG	1 cut(s)	351
EcoO109I	RGGNCCY	1 cut(s)	352
EcoRI	GAATTC	1 cut(s)	159
EcoRII	CCWGG	1 cut(s)	106
EcoT22I	ATGCAT	1 cut(s)	132
EcoT38I	GRGCYC	1 cut(s)	60
FaeI	CATG	3 cut(s)	130, 134, 139
FaiI	YATR	7 cut(s)	73, 128, 132, 137, 183, 255, 341
FatI	CATG	3 cut(s)	126, 130, 135
Fnu4HI	GCNGC	2 cut(s)	99, 336
FokI	GGATG	1 cut(s)	150
FriOI	GRGCYC	1 cut(s)	60
Fsp4HI	GCNGC	2 cut(s)	99, 336
GluI	GCNGC	2 cut(s)	99, 336
HaeIII	GGCC	2 cut(s)	58, 200
HapII	CCGG	2 cut(s)	10, 287
Hin1II	CATG	3 cut(s)	130, 134, 139
HindIII	AAGCTT	1 cut(s)	119
HpaII	CCGG	2 cut(s)	10, 287
HphI	GGTGA	1 cut(s)	256
Hpy188I	TCNGA	1 cut(s)	210
HpyAV	CCTTC	3 cut(s)	148, 241, 286
HpyCH4III	ACNGT	2 cut(s)	22, 77
HpyCH4V	TGCA	2 cut(s)	101, 130
HpyF10VI	GCNNNNNNNGC	3 cut(s)	98, 127, 136
Hsp92II	CATG	3 cut(s)	130, 134, 139
Kzo9I	GATC	2 cut(s)	24, 358
LpnPI	CCDG	5 cut(s)	23, 80, 93, 120, 300
Lsp1109I	GCAGC	2 cut(s)	85, 322
MalI	GATC	2 cut(s)	26, 360
MboI	GATC	2 cut(s)	24, 358
MboII	GAAGA	4 cut(s)	233, 236, 239, 242
MhlI	GDGCHC	1 cut(s)	60
MluCI	AATT	1 cut(s)	159
MnlI	CCTC	9 cut(s)	190, 204, 207, 211, 269, 289, 297, 301, 365
Mph1103I	ATGCAT	1 cut(s)	132
MseI	TTAA	1 cut(s)	282
MslI	CAYNNNNRTG	1 cut(s)	168
MspI	CCGG	2 cut(s)	10, 287
MspR9I	CCNGG	2 cut(s)	11, 108
MvaI	CCWGG	1 cut(s)	108
MwoI	GCNNNNNNNGC	3 cut(s)	98, 127, 136
NciI	CCSGG	1 cut(s)	11
NdeII	GATC	2 cut(s)	24, 358
NlaIII	CATG	3 cut(s)	130, 134, 139
NlaIV	GGNNCC	2 cut(s)	58, 353
NsiI	ATGCAT	1 cut(s)	132
NspI	RCATGY	1 cut(s)	139
PceI	AGGCCT	1 cut(s)	200
PkrI	GCNGC	2 cut(s)	100, 337
PpuMI	RGGWCCY	1 cut(s)	352
Psp5II	RGGWCCY	1 cut(s)	352
Psp6I	CCWGG	1 cut(s)	106
PspGI	CCWGG	1 cut(s)	106
PspN4I	GGNNCC	2 cut(s)	58, 353
PspOMI	GGGCCC	1 cut(s)	56
PspPI	GGNCC	3 cut(s)	56, 57, 352
PspPPI	RGGWCCY	1 cut(s)	352
PstI	CTGCAG	1 cut(s)	103
PstNI	CAGNNNCTG	1 cut(s)	107
RseI	CAYNNNNRTG	1 cut(s)	168
SaqAI	TTAA	1 cut(s)	282
SatI	GCNGC	2 cut(s)	99, 336
Sau3AI	GATC	2 cut(s)	24, 358
Sau96I	GGNCC	3 cut(s)	56, 57, 352
ScrFI	CCNGG	2 cut(s)	11, 108
SduI	GDGCHC	1 cut(s)	60
SetI	ASST	6 cut(s)	109, 123, 182, 246, 312, 337
SfcI	CTRYAG	1 cut(s)	99
SinI	GGWCC	1 cut(s)	352
SmiMI	CAYNNNNRTG	1 cut(s)	168
SmlI	CTYRAG	1 cut(s)	140
SmoI	CTYRAG	1 cut(s)	140
Sse9I	AATT	1 cut(s)	159
SseBI	AGGCCT	1 cut(s)	200
SsiI	CCGC	1 cut(s)	45
StuI	AGGCCT	1 cut(s)	200
StyD4I	CCNGG	2 cut(s)	9, 106
TaaI	ACNGT	2 cut(s)	22, 77
TaqI	TCGA	2 cut(s)	195, 357
TasI	AATT	1 cut(s)	159
Tru1I	TTAA	1 cut(s)	282
Tru9I	TTAA	1 cut(s)	282
TscAI	CASTG	1 cut(s)	82
TseI	GCWGC	2 cut(s)	98, 335
TspDTI	ATGAA	2 cut(s)	152, 281
TspRI	CASTG	1 cut(s)	82
VpaK11BI	GGWCC	1 cut(s)	352
XapI	RAATTY	1 cut(s)	159
XceI	RCATGY	1 cut(s)	139
Zsp2I	ATGCAT	1 cut(s)	132

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.