Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0017725.1

Orthogroup ID

OG0009734

Physical Location & Seq

Genomic Coordinates Forward (+)

2735 .. 3086

Gene Structure 352 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0017725.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 258 bp

atggcggcctctgagagtcggaaacatgcttcgtcttcttcgtctgagactccacagccgccgaggagttacggcatcacgaagccgatttttctctccgggccgtcgcagtctgatcgtcaacgaaatatcgaactcgagaagttcttggttgattcggggctgtatgagagcaaagacgaggctgcgaaaagagaagaggttcttggctgcattggtcaggtaattgatcattatccctgcctcgcaatttattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004652 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005847 GO:0005849 GO:0006139 GO:0006378 GO:0006396 GO:0006397 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0010467 GO:0016070 GO:0016071 GO:0016740 GO:0016772 GO:0016779 GO:0031123 GO:0031124 GO:0031974 GO:0031981 GO:0032991 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043631 GO:0044237 GO:0044238 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044451 GO:0044464 GO:0046483 GO:0070013 GO:0070566 GO:0071704 GO:0090304 GO:1901360

KEGG Pathways

Metabolic & Signaling

ko03015 map03015

Pfam Domains

Protein Families

NTP_transf_2 PAP_RNA-bind PAP_central

Protein Analysis

85

Amino Acids

9.4

Weight (kDa)

5.61

Isoelectric Point (pI)

77.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009734)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0318691 RchiOBHm_Chr4g0417811 RchiOBHm_Chr5g0056321
rosa_laevigata	RLG00000001224 RLG00000013183
rosa_multiflora	Rmu_sc0000982.1_g000066 Rmu_sc0004761.1_g000013 Rmu_sc0017725.1_g000002 Rmu_ssc0000259.1_g000041
rosa_roxburghii	Rroxscaffold_7G00180230
rosa_rugosa	Rorug01G0356200
rosa_samantha	Rh1AG035900 Rh1DG306000 Rh2BG076200 Rh2CG032100 Rh2CG078400 Rh2CG583600 Rh5BG380600 Rh5DG393700 Rh5DG523700 Rh7AG278300 Rh7CG297300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	5, 59
AjuI	GAANNNNNNNTTGG	2 cut(s)	189, 221
Alw26I	GTCTC	1 cut(s)	41
Ama87I	CYCGRG	1 cut(s)	137
AoxI	GGCC	2 cut(s)	6, 101
ApeKI	GCWGC	2 cut(s)	185, 210
Asp700I	GAANNNNTTC	1 cut(s)	201
AspS9I	GGNCC	1 cut(s)	101
AsuC2I	CCSGG	1 cut(s)	100
AvaI	CYCGRG	1 cut(s)	137
BbsI	GAAGAC	1 cut(s)	27
BbvI	GCAGC	2 cut(s)	172, 197
BceAI	ACGGC	2 cut(s)	88, 88
BcgI	CGANNNNNNTGC	2 cut(s)	98, 132
BclI	TGATCA	1 cut(s)	229
BcnI	CCSGG	1 cut(s)	100
BcoDI	GTCTC	1 cut(s)	41
BisI	GCNGC	4 cut(s)	6, 59, 186, 211
BlsI	GCNGC	4 cut(s)	7, 60, 187, 212
Bme1390I	CCNGG	1 cut(s)	100
BmeT110I	CYCGRG	1 cut(s)	137
BmgT120I	GGNCC	1 cut(s)	101
BmrFI	CCNGG	1 cut(s)	100
BmsI	GCATC	1 cut(s)	84
BpiI	GAAGAC	1 cut(s)	27
BpuMI	CCSGG	1 cut(s)	100
BsaBI	GATNNNNATC	1 cut(s)	234
BsaJI	CCNNGG	1 cut(s)	62
Bse8I	GATNNNNATC	1 cut(s)	234
BseDI	CCNNGG	1 cut(s)	62
BseJI	GATNNNNATC	1 cut(s)	234
BseMII	CTCAG	1 cut(s)	36
BseRI	GAGGAG	1 cut(s)	79
BseXI	GCAGC	2 cut(s)	172, 197
BshFI	GGCC	2 cut(s)	8, 103
BsiHKCI	CYCGRG	1 cut(s)	137
BsiSI	CCGG	1 cut(s)	99
BsmAI	GTCTC	1 cut(s)	41
BsnI	GGCC	2 cut(s)	8, 103
BsoBI	CYCGRG	1 cut(s)	137
Bsp143I	GATC	2 cut(s)	115, 229
BspACI	CCGC	2 cut(s)	5, 59
BspANI	GGCC	2 cut(s)	8, 103
BspCNI	CTCAG	2 cut(s)	4, 37
BssECI	CCNNGG	1 cut(s)	62
BssMI	GATC	2 cut(s)	115, 229
Bst6I	CTCTTC	1 cut(s)	192
BstDEI	CTNAG	2 cut(s)	12, 45
BstKTI	GATC	2 cut(s)	118, 232
BstMAI	GTCTC	1 cut(s)	41
BstMBI	GATC	2 cut(s)	115, 229
BstNSI	RCATGY	1 cut(s)	29
BstSCI	CCNGG	1 cut(s)	98
BstV1I	GCAGC	2 cut(s)	172, 197
BstV2I	GAAGAC	1 cut(s)	27
BsuRI	GGCC	2 cut(s)	8, 103
Cfr13I	GGNCC	1 cut(s)	101
CviAII	CATG	1 cut(s)	26
CviJI	RGCY	7 cut(s)	8, 58, 85, 103, 163, 185, 210
CviKI_1	RGCY	7 cut(s)	8, 58, 85, 103, 163, 185, 210
DdeI	CTNAG	2 cut(s)	12, 45
DpnI	GATC	2 cut(s)	117, 231
DpnII	GATC	2 cut(s)	115, 229
Eam1104I	CTCTTC	1 cut(s)	192
EarI	CTCTTC	1 cut(s)	192
Eco88I	CYCGRG	1 cut(s)	137
FaeI	CATG	1 cut(s)	29
FaiI	YATR	2 cut(s)	27, 168
FalI	AAGNNNNNCTT	2 cut(s)	189, 221
FatI	CATG	1 cut(s)	25
FbaI	TGATCA	1 cut(s)	229
Fnu4HI	GCNGC	4 cut(s)	6, 59, 186, 211
Fsp4HI	GCNGC	4 cut(s)	6, 59, 186, 211
GluI	GCNGC	4 cut(s)	6, 59, 186, 211
HaeIII	GGCC	2 cut(s)	8, 103
HapII	CCGG	1 cut(s)	99
Hin1II	CATG	1 cut(s)	29
HincII	GTYRAC	1 cut(s)	122
HindII	GTYRAC	1 cut(s)	122
HinfI	GANTC	3 cut(s)	16, 49, 155
HpaII	CCGG	1 cut(s)	99
Hpy166II	GTNNAC	1 cut(s)	122
Hpy188I	TCNGA	4 cut(s)	13, 21, 46, 115
Hpy188III	TCNNGA	2 cut(s)	79, 139
Hpy8I	GTNNAC	1 cut(s)	122
Hpy99I	CGWCG	1 cut(s)	109
HpyCH4V	TGCA	1 cut(s)	213
HpyF3I	CTNAG	2 cut(s)	12, 45
Hsp92II	CATG	1 cut(s)	29
Ksp22I	TGATCA	1 cut(s)	229
Kzo9I	GATC	2 cut(s)	115, 229
LpnPI	CCDG	3 cut(s)	112, 206, 253
Lsp1109I	GCAGC	2 cut(s)	172, 197
LweI	GCATC	1 cut(s)	84
MaeIII	GTNAC	1 cut(s)	68
MalI	GATC	2 cut(s)	117, 231
MboI	GATC	2 cut(s)	115, 229
MboII	GAAGA	3 cut(s)	27, 30, 209
MluCI	AATT	2 cut(s)	225, 249
MlyI	GAGTC	2 cut(s)	25, 43
MnlI	CCTC	5 cut(s)	19, 57, 175, 193, 254
MroXI	GAANNNNTTC	1 cut(s)	201
MspI	CCGG	1 cut(s)	99
MspR9I	CCNGG	1 cut(s)	100
NciI	CCSGG	1 cut(s)	100
NdeII	GATC	2 cut(s)	115, 229
NlaIII	CATG	1 cut(s)	29
NmeAIII	GCCGAG	1 cut(s)	87
NspI	RCATGY	1 cut(s)	29
PaeR7I	CTCGAG	1 cut(s)	137
PcsI	WCGNNNNNNNCGW	1 cut(s)	38
PdmI	GAANNNNTTC	1 cut(s)	201
PfeI	GAWTC	1 cut(s)	155
PkrI	GCNGC	4 cut(s)	7, 60, 187, 212
PleI	GAGTC	2 cut(s)	24, 43
PpsI	GAGTC	2 cut(s)	24, 43
PspPI	GGNCC	1 cut(s)	101
SatI	GCNGC	4 cut(s)	6, 59, 186, 211
Sau3AI	GATC	2 cut(s)	115, 229
Sau96I	GGNCC	1 cut(s)	101
SchI	GAGTC	2 cut(s)	25, 43
ScrFI	CCNGG	1 cut(s)	100
SetI	ASST	2 cut(s)	204, 225
SfaNI	GCATC	1 cut(s)	84
Sfr274I	CTCGAG	1 cut(s)	137
SlaI	CTCGAG	1 cut(s)	137
SmlI	CTYRAG	1 cut(s)	137
SmoI	CTYRAG	1 cut(s)	137
Sse9I	AATT	2 cut(s)	225, 249
SsiI	CCGC	2 cut(s)	5, 59
StyD4I	CCNGG	1 cut(s)	98
TaqI	TCGA	2 cut(s)	132, 138
TasI	AATT	2 cut(s)	225, 249
TauI	GCSGC	2 cut(s)	8, 61
TfiI	GAWTC	1 cut(s)	155
TseI	GCWGC	2 cut(s)	185, 210
XceI	RCATGY	1 cut(s)	29
XhoI	CTCGAG	1 cut(s)	137
XmnI	GAANNNNTTC	1 cut(s)	201

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.