Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0018789.1

Orthogroup ID

OG0005408

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1185

Gene Structure 1185 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0018789.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1185 bp

cccattgaccaagatgttgacttgaagagcggaacggcgatcacggcctggattgactacaagaacgaccaagaaacgcttaaggtgtacctgagctactccgggttcaaacccgagacccctgttttgaacgtggggattgatctttctgggtatctgaaggaggttatgtatgtggggttctctgcttcaactgaaggaagcactgagcttcatgagattgagaattggagcttcaggacatctgggtttgtgccgaaaaggcccacattgcatcctcacaatgtgtctgatacttatgtgattgtcagtccaaggctgccggcgccggagaagggacacaagaggcggctcgggctggggcttgggattgccgggccggcgttcttttgtgttgcgctggtggttttcgggtatgtgagtgtgaggaagtggagggaggtgaggagggtgaagagttttaaagcagaggtggtggcagggccgaggcagtttagctatagagagctgagggcagctacaggagggtttcatgggagtaggattattgggcatggcgcatttgggactgtgtacaaggcgtttttcgtggcgtcggggactattgcggcggtgaagaggtccaggcattctcatgaaggtaagactgagtttcttgctgagttgtctattatagcttgcttgaggcacaagaatttagtgcatttgcaagggtggtgtgttgagaaaggtgagttgctgcttgtgtatgatttcatgccgaatggtagtcttgagagagtgctttaccaagaaagtgaggagggtaacttgttggattggcctcataggcaaaatgttgcgattggtttggcgtctgttttgacgtatatgcatcaagaatgtgagcagcaagtgattcatagggatattaagactggtaatgtgttgctggatgggaatttcaatgcaaagcttggtgattttggattggcaaagctcatggatcatgataagagccctgtttcgaccctgacagctggaacaatggggtaccttgcgcccgagtatctccagtacgggaaagcaactgagaagactgatgctttcagctatggtgtggtcatacttgaattggcttgtgggaggagaccaattgagagaattccggattgtcacaaaatggtgaatttggttgattgggtt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0002229 GO:0002239 GO:0005575 GO:0005623 GO:0005886 GO:0006950 GO:0006952 GO:0008150 GO:0009605 GO:0009607 GO:0016020 GO:0043207 GO:0044464 GO:0050896 GO:0051704 GO:0051707 GO:0071944 GO:0098542

KEGG Pathways

Metabolic & Signaling

ko04010 ko04064 ko04620 ko04624 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05169 map04010 map04064 map04620 map04624 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05169

Pfam Domains

Protein Families

Lectin_legB Pkinase Pkinase_Tyr

Protein Analysis

395

Amino Acids

44.05

Weight (kDa)

8.26

Isoelectric Point (pI)

41.32

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005408)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G55830
fragaria_vesca	FvH4_2g31170 FvH4_3g42990 FvH4_4g09342 FvH4_4g11641
malus_domestica	MD03G1026600.v1.1 MD11G1030600.v1.1
prunus_persica	Prupe.6G024000_v2.0.a1
pyrus_communis	pycom03g02180 pycom11g02420 pycom11g02430 pycom11g02480
rosa_chinensis	RchiOBHm_Chr5g0077031
rosa_laevigata	RLG00000036643
rosa_multiflora	Rmu_sc0003323.1_g000008 Rmu_sc0018789.1_g000001 Rmu_ssc0000470.1_g000027
rosa_roxburghii	Rroxscaffold_1G00005100
rosa_rugosa	Rorug05G0450500
rosa_samantha	Rh5AG505100 Rh5BG416900 Rh5BG526800 Rh5CG441400 Rh5CG550600 Rh5DG539000 Rh6AG352200 Rh6CG162900 Rh6DG154500
rosa_wichuraiana	Rw5G047130

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	1032
AccB1I	GGYRCC	2 cut(s)	325, 1032
AccBSI	CCGCTC	1 cut(s)	30
AccIII	TCCGGA	1 cut(s)	1147
AciI	CCGC	4 cut(s)	30, 349, 608, 611
AclWI	GGATC	1 cut(s)	993
AcsI	RAATTY	4 cut(s)	694, 940, 1143, 1168
AcuI	CTGAAG	3 cut(s)	179, 216, 220
AcyI	GRCGYC	3 cut(s)	326, 593, 854
AdeI	CACNNNGTG	1 cut(s)	286
AfaI	GTAC	4 cut(s)	89, 575, 1034, 1058
AfiI	CCNNNNNNNGG	1 cut(s)	335
AflII	CTTAAG	1 cut(s)	80
AgsI	TTSAA	6 cut(s)	25, 109, 130, 192, 946, 1112
AjnI	CCWGG	2 cut(s)	47, 623
Alw26I	GTCTC	2 cut(s)	110, 1123
AlwI	GGATC	1 cut(s)	993
Ama87I	CYCGRG	3 cut(s)	113, 353, 1043
Aor13HI	TCCGGA	1 cut(s)	1147
AoxI	GGCC	5 cut(s)	45, 263, 377, 482, 821
ApeKI	GCWGC	4 cut(s)	319, 515, 739, 889
ApoI	RAATTY	4 cut(s)	694, 940, 1143, 1168
ArsI	GACNNNNNNTTYG	2 cut(s)	109, 141
Asp718I	GGTACC	1 cut(s)	1032
AspLEI	GCGC	4 cut(s)	328, 400, 560, 1042
AspS9I	GGNCC	4 cut(s)	264, 377, 482, 621
AsuC2I	CCSGG	2 cut(s)	103, 376
AsuHPI	GGTGA	6 cut(s)	454, 463, 625, 743, 971, 1177
AvaI	CYCGRG	3 cut(s)	113, 353, 1043
AvaII	GGWCC	1 cut(s)	621
BaeI	ACNNNNGTAYC	2 cut(s)	285, 318
BanI	GGYRCC	2 cut(s)	325, 1032
BanII	GRGCYC	1 cut(s)	1001
BbsI	GAAGAC	1 cut(s)	1082
BbvCI	CCTCAGC	1 cut(s)	509
BbvI	GCAGC	4 cut(s)	306, 527, 726, 901
BccI	CCATC	1 cut(s)	929
BceAI	ACGGC	2 cut(s)	51, 60
BciT130I	CCWGG	2 cut(s)	49, 625
BcnI	CCSGG	2 cut(s)	103, 376
BcoDI	GTCTC	2 cut(s)	110, 1123
BfmI	CTRYAG	2 cut(s)	499, 519
BfoI	RGCGCY	1 cut(s)	329
BfrI	CTTAAG	1 cut(s)	80
BglI	GCCNNNNNGGC	3 cut(s)	262, 380, 829
BisI	GCNGC	6 cut(s)	320, 350, 516, 609, 740, 890
BlsI	GCNGC	6 cut(s)	321, 351, 517, 610, 741, 891
Bme1390I	CCNGG	4 cut(s)	49, 103, 376, 625
Bme18I	GGWCC	1 cut(s)	621
BmeT110I	CYCGRG	3 cut(s)	113, 353, 1043
BmgT120I	GGNCC	4 cut(s)	264, 377, 482, 621
BmiI	GGNNCC	2 cut(s)	327, 1034
BmrFI	CCNGG	4 cut(s)	49, 103, 376, 625
BmsI	GCATC	3 cut(s)	283, 883, 1072
BpiI	GAAGAC	1 cut(s)	1082
BpmI	CTGGAG	1 cut(s)	1037
Bpu10I	CCTNAGC	2 cut(s)	92, 509
BpuEI	CTTGAG	2 cut(s)	703, 794
BpuMI	CCSGG	2 cut(s)	103, 376
BsaHI	GRCGYC	3 cut(s)	326, 593, 854
BsaI	GGTCTC	2 cut(s)	110, 1123
BsaJI	CCNNGG	2 cut(s)	314, 485
BsaWI	WCCGGW	1 cut(s)	1147
BsaXI	ACNNNNNCTCC	2 cut(s)	155, 185
Bsc4I	CCNNNNNNNGG	1 cut(s)	335
Bse118I	RCCGGY	2 cut(s)	322, 379
Bse1I	ACTGG	2 cut(s)	922, 1054
Bse3DI	GCAATG	1 cut(s)	269
BseAI	TCCGGA	1 cut(s)	1147
BseBI	CCWGG	2 cut(s)	49, 625
BseDI	CCNNGG	2 cut(s)	314, 485
BseGI	GGATG	2 cut(s)	274, 940
BseLI	CCNNNNNNNGG	1 cut(s)	335
BseMI	GCAATG	1 cut(s)	269
BseMII	CTCAG	6 cut(s)	83, 198, 500, 639, 651, 1062
BseNI	ACTGG	2 cut(s)	922, 1054
BseRI	GAGGAG	3 cut(s)	460, 815, 1141
BseXI	GCAGC	4 cut(s)	306, 527, 726, 901
BseYI	CCCAGC	1 cut(s)	358
BshFI	GGCC	5 cut(s)	47, 265, 379, 484, 823
BshNI	GGYRCC	2 cut(s)	325, 1032
BsiHKCI	CYCGRG	3 cut(s)	113, 353, 1043
BsiSI	CCGG	6 cut(s)	102, 323, 329, 375, 380, 1148
BslFI	GGGAC	3 cut(s)	351, 580, 613
BslI	CCNNNNNNNGG	1 cut(s)	335
BsmAI	GTCTC	2 cut(s)	110, 1123
BsmFI	GGGAC	3 cut(s)	351, 580, 613
BsmI	GAATGC	1 cut(s)	628
BsnI	GGCC	5 cut(s)	47, 265, 379, 484, 823
Bso31I	GGTCTC	2 cut(s)	110, 1123
BsoBI	CYCGRG	3 cut(s)	113, 353, 1043
Bsp1286I	GDGCHC	1 cut(s)	1001
Bsp13I	TCCGGA	1 cut(s)	1147
Bsp1407I	TGTACA	1 cut(s)	573
Bsp143I	GATC	3 cut(s)	39, 142, 985
BspACI	CCGC	4 cut(s)	30, 349, 608, 611
BspANI	GGCC	5 cut(s)	47, 265, 379, 484, 823
BspCNI	CTCAG	6 cut(s)	84, 199, 501, 640, 652, 1063
BspEI	TCCGGA	1 cut(s)	1147
BspHI	TCATGA	3 cut(s)	214, 634, 988
BspLI	GGNNCC	2 cut(s)	327, 1034
BspPI	GGATC	1 cut(s)	993
BspQI	GCTCTTC	1 cut(s)	20
BspT107I	GGYRCC	2 cut(s)	325, 1032
BspTI	CTTAAG	1 cut(s)	80
BspTNI	GGTCTC	2 cut(s)	110, 1123
BsrBI	CCGCTC	1 cut(s)	30
BsrDI	GCAATG	1 cut(s)	269
BsrFI	RCCGGY	2 cut(s)	322, 379
BsrGI	TGTACA	1 cut(s)	573
BsrI	ACTGG	2 cut(s)	922, 1054
BssAI	RCCGGY	2 cut(s)	322, 379
BssECI	CCNNGG	2 cut(s)	314, 485
BssMI	GATC	3 cut(s)	39, 142, 985
BssNI	GRCGYC	3 cut(s)	326, 593, 854
BssT1I	CCWWGG	1 cut(s)	314
Bst2UI	CCWGG	2 cut(s)	49, 625
Bst4CI	ACNGT	1 cut(s)	571
Bst6I	CTCTTC	3 cut(s)	20, 449, 611
BstACI	GRCGYC	3 cut(s)	326, 593, 854
BstAFI	CTTAAG	1 cut(s)	80
BstAUI	TGTACA	1 cut(s)	573
BstC8I	GCNNGC	3 cut(s)	324, 381, 679
BstDEI	CTNAG	6 cut(s)	92, 207, 509, 648, 660, 1071
BstF5I	GGATG	2 cut(s)	274, 940
BstH2I	RGCGCY	1 cut(s)	329
BstHHI	GCGC	4 cut(s)	328, 400, 560, 1042
BstKTI	GATC	3 cut(s)	42, 145, 988
BstMAI	GTCTC	2 cut(s)	110, 1123
BstMBI	GATC	3 cut(s)	39, 142, 985
BstMWI	GCNNNNNNNGC	7 cut(s)	44, 262, 271, 325, 355, 380, 829
BstNI	CCWGG	2 cut(s)	49, 625
BstSCI	CCNGG	4 cut(s)	47, 101, 374, 623
BstSFI	CTRYAG	2 cut(s)	499, 519
BstV1I	GCAGC	4 cut(s)	306, 527, 726, 901
BstV2I	GAAGAC	1 cut(s)	1082
BsuRI	GGCC	5 cut(s)	47, 265, 379, 484, 823
BtsCI	GGATG	2 cut(s)	274, 940
BtsIMutI	CAGTG	1 cut(s)	204
Cac8I	GCNNGC	3 cut(s)	324, 381, 679
CciI	TCATGA	3 cut(s)	214, 634, 988
CfoI	GCGC	4 cut(s)	328, 400, 560, 1042
Cfr10I	RCCGGY	2 cut(s)	322, 379
Cfr13I	GGNCC	4 cut(s)	264, 377, 482, 621
CseI	GACGC	2 cut(s)	582, 843
Csp6I	GTAC	4 cut(s)	88, 574, 1033, 1057
CviAII	CATG	7 cut(s)	215, 533, 554, 635, 757, 982, 989
CviQI	GTAC	4 cut(s)	88, 574, 1033, 1057
DdeI	CTNAG	6 cut(s)	92, 207, 509, 648, 660, 1071
DinI	GGCGCC	1 cut(s)	327
DpnI	GATC	3 cut(s)	41, 144, 987
DpnII	GATC	3 cut(s)	39, 142, 985
DraI	TTTAAA	1 cut(s)	463
DraIII	CACNNNGTG	1 cut(s)	286
Eam1104I	CTCTTC	3 cut(s)	20, 449, 611
EarI	CTCTTC	3 cut(s)	20, 449, 611
Eco130I	CCWWGG	1 cut(s)	314
Eco24I	GRGCYC	1 cut(s)	1001
Eco31I	GGTCTC	2 cut(s)	110, 1123
Eco47I	GGWCC	1 cut(s)	621
Eco57I	CTGAAG	3 cut(s)	179, 216, 220
Eco88I	CYCGRG	3 cut(s)	113, 353, 1043
EcoRI	GAATTC	1 cut(s)	1143
EcoRII	CCWGG	2 cut(s)	47, 623
EcoT14I	CCWWGG	1 cut(s)	314
EcoT22I	ATGCAT	1 cut(s)	876
EcoT38I	GRGCYC	1 cut(s)	1001
EgeI	GGCGCC	1 cut(s)	327
EheI	GGCGCC	1 cut(s)	327
ErhI	CCWWGG	1 cut(s)	314
FaeI	CATG	7 cut(s)	218, 536, 557, 638, 760, 985, 992
FalI	AAGNNNNNCTT	2 cut(s)	63, 95
FaqI	GGGAC	3 cut(s)	351, 580, 613
FatI	CATG	7 cut(s)	214, 532, 553, 634, 756, 981, 988
Fnu4HI	GCNGC	6 cut(s)	320, 350, 516, 609, 740, 890
FokI	GGATG	2 cut(s)	261, 947
FriOI	GRGCYC	1 cut(s)	1001
Fsp4HI	GCNGC	6 cut(s)	320, 350, 516, 609, 740, 890
GlaI	GCGC	4 cut(s)	327, 399, 559, 1041
GluI	GCNGC	6 cut(s)	320, 350, 516, 609, 740, 890
GsaI	CCCAGC	1 cut(s)	362
GsuI	CTGGAG	1 cut(s)	1037
HaeII	RGCGCY	1 cut(s)	329
HaeIII	GGCC	5 cut(s)	47, 265, 379, 484, 823
HapII	CCGG	6 cut(s)	102, 323, 329, 375, 380, 1148
HgaI	GACGC	2 cut(s)	582, 843
HhaI	GCGC	4 cut(s)	328, 400, 560, 1042
Hin1I	GRCGYC	3 cut(s)	326, 593, 854
Hin1II	CATG	7 cut(s)	218, 536, 557, 638, 760, 985, 992
Hin6I	GCGC	4 cut(s)	326, 398, 558, 1040
HinP1I	GCGC	4 cut(s)	326, 398, 558, 1040
HincII	GTYRAC	1 cut(s)	19
HindII	GTYRAC	1 cut(s)	19
HindIII	AAGCTT	1 cut(s)	953
HinfI	GANTC	1 cut(s)	898
HpaII	CCGG	6 cut(s)	102, 323, 329, 375, 380, 1148
HphI	GGTGA	6 cut(s)	454, 463, 625, 743, 971, 1177
Hpy166II	GTNNAC	3 cut(s)	19, 88, 574
Hpy188I	TCNGA	2 cut(s)	159, 292
Hpy188III	TCNNGA	7 cut(s)	215, 238, 635, 773, 878, 989, 1148
Hpy8I	GTNNAC	3 cut(s)	19, 88, 574
Hpy99I	CGWCG	1 cut(s)	598
HpyAV	CCTTC	4 cut(s)	154, 191, 328, 632
HpyCH4III	ACNGT	1 cut(s)	571
HpyCH4IV	ACGT	2 cut(s)	132, 866
HpyCH4V	TGCA	5 cut(s)	274, 703, 709, 874, 950
HpyF10VI	GCNNNNNNNGC	7 cut(s)	44, 262, 271, 325, 355, 380, 829
HpyF3I	CTNAG	6 cut(s)	92, 207, 509, 648, 660, 1071
HpySE526I	ACGT	2 cut(s)	132, 866
Hsp92I	GRCGYC	3 cut(s)	326, 593, 854
Hsp92II	CATG	7 cut(s)	218, 536, 557, 638, 760, 985, 992
HspAI	GCGC	4 cut(s)	326, 398, 558, 1040
KasI	GGCGCC	1 cut(s)	325
Kpn2I	TCCGGA	1 cut(s)	1147
KpnI	GGTACC	1 cut(s)	1036
KroI	GCCGGC	2 cut(s)	322, 379
KroNI	GCCGGC	2 cut(s)	324, 381
Kzo9I	GATC	3 cut(s)	39, 142, 985
LguI	GCTCTTC	1 cut(s)	20
LmnI	GCTCC	1 cut(s)	231
Lsp1109I	GCAGC	4 cut(s)	306, 527, 726, 901
LweI	GCATC	3 cut(s)	283, 883, 1072
MaeII	ACGT	2 cut(s)	132, 866
MaeIII	GTNAC	2 cut(s)	806, 1154
MalI	GATC	3 cut(s)	41, 144, 987
MbiI	CCGCTC	1 cut(s)	30
MboI	GATC	3 cut(s)	39, 142, 985
MboII	GAAGA	4 cut(s)	37, 466, 628, 1087
MfeI	CAATTG	1 cut(s)	1134
MhlI	GDGCHC	1 cut(s)	1001
MluCI	AATT	7 cut(s)	226, 694, 940, 1112, 1134, 1143, 1168
Mly113I	GGCGCC	1 cut(s)	326
MmeI	TCCRAC	1 cut(s)	795
Mph1103I	ATGCAT	1 cut(s)	876
MroI	TCCGGA	1 cut(s)	1147
MroNI	GCCGGC	2 cut(s)	322, 379
MseI	TTAA	3 cut(s)	81, 462, 912
MslI	CAYNNNNRTG	1 cut(s)	633
MspA1I	CMGCKG	1 cut(s)	1019
MspCI	CTTAAG	1 cut(s)	80
MspI	CCGG	6 cut(s)	102, 323, 329, 375, 380, 1148
MspR9I	CCNGG	4 cut(s)	49, 103, 376, 625
MunI	CAATTG	1 cut(s)	1134
Mva1269I	GAATGC	1 cut(s)	628
MvaI	CCWGG	2 cut(s)	49, 625
MwoI	GCNNNNNNNGC	7 cut(s)	44, 262, 271, 325, 355, 380, 829
NaeI	GCCGGC	2 cut(s)	324, 381
NarI	GGCGCC	1 cut(s)	326
NciI	CCSGG	2 cut(s)	103, 376
NdeII	GATC	3 cut(s)	39, 142, 985
NgoMIV	GCCGGC	2 cut(s)	322, 379
NlaIII	CATG	7 cut(s)	218, 536, 557, 638, 760, 985, 992
NlaIV	GGNNCC	2 cut(s)	327, 1034
NmeAIII	GCCGAG	1 cut(s)	510
NmuCI	GTSAC	1 cut(s)	1154
NsiI	ATGCAT	1 cut(s)	876
PagI	TCATGA	3 cut(s)	214, 634, 988
PciSI	GCTCTTC	1 cut(s)	20
PctI	GAATGC	1 cut(s)	628
PdiI	GCCGGC	2 cut(s)	324, 381
PfeI	GAWTC	1 cut(s)	898
PkrI	GCNGC	6 cut(s)	321, 351, 517, 610, 741, 891
PluTI	GGCGCC	1 cut(s)	329
Psp6I	CCWGG	2 cut(s)	47, 623
PspFI	CCCAGC	1 cut(s)	358
PspGI	CCWGG	2 cut(s)	47, 623
PspN4I	GGNNCC	2 cut(s)	327, 1034
PspPI	GGNCC	4 cut(s)	264, 377, 482, 621
PsrI	GAACNNNNNNTAC	2 cut(s)	164, 196
PvuII	CAGCTG	1 cut(s)	1019
RsaI	GTAC	4 cut(s)	89, 575, 1034, 1058
RsaNI	GTAC	4 cut(s)	88, 574, 1033, 1057
RseI	CAYNNNNRTG	1 cut(s)	633
SapI	GCTCTTC	1 cut(s)	20
SaqAI	TTAA	3 cut(s)	81, 462, 912
SatI	GCNGC	6 cut(s)	320, 350, 516, 609, 740, 890
Sau3AI	GATC	3 cut(s)	39, 142, 985
Sau96I	GGNCC	4 cut(s)	264, 377, 482, 621
ScrFI	CCNGG	4 cut(s)	49, 103, 376, 625
SduI	GDGCHC	1 cut(s)	1001
SfaNI	GCATC	3 cut(s)	283, 883, 1072
SfcI	CTRYAG	2 cut(s)	499, 519
SfoI	GGCGCC	1 cut(s)	327
SinI	GGWCC	1 cut(s)	621
SmiMI	CAYNNNNRTG	1 cut(s)	633
SmlI	CTYRAG	3 cut(s)	80, 682, 773
SmoI	CTYRAG	3 cut(s)	80, 682, 773
Sse9I	AATT	7 cut(s)	226, 694, 940, 1112, 1134, 1143, 1168
SsiI	CCGC	4 cut(s)	30, 349, 608, 611
SspDI	GGCGCC	1 cut(s)	325
StyD4I	CCNGG	4 cut(s)	47, 101, 374, 623
StyI	CCWWGG	1 cut(s)	314
TaaI	ACNGT	1 cut(s)	571
TaiI	ACGT	2 cut(s)	135, 869
TaqI	TCGA	1 cut(s)	1007
TasI	AATT	7 cut(s)	226, 694, 940, 1112, 1134, 1143, 1168
TatI	WGTACW	1 cut(s)	573
TauI	GCSGC	2 cut(s)	352, 611
TfiI	GAWTC	1 cut(s)	898
Tru1I	TTAA	3 cut(s)	81, 462, 912
Tru9I	TTAA	3 cut(s)	81, 462, 912
TscAI	CASTG	1 cut(s)	211
TseFI	GTSAC	1 cut(s)	1154
TseI	GCWGC	4 cut(s)	319, 515, 739, 889
Tsp45I	GTSAC	1 cut(s)	1154
TspDTI	ATGAA	5 cut(s)	203, 521, 651, 745, 890
TspRI	CASTG	1 cut(s)	211
Vha464I	CTTAAG	1 cut(s)	80
VpaK11BI	GGWCC	1 cut(s)	621
XapI	RAATTY	4 cut(s)	694, 940, 1143, 1168
Zsp2I	ATGCAT	1 cut(s)	876

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.