Rmu_sc0022686.1_g000002

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0022686.1
Physical Location & Seq
Forward (+)
630 .. 1586
957 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0022686.1_g000002.1.cds

Sequence Viewer

Length: 348 bp
atggaaagagaagttccactagcggagttgcgcttagtagagactagctcgcttgcaagatggaaagaaagaagttctgctagcggagttgcgcttagtgtcgtcgtcttcaagcttcgccctgcgttccgagaagaagattgctacgattccgtgaagttatcaatttttgaagcacgaaggtctcctacagtgaagggaagcgccttcgatcgcaccaaagctttcacctttgaggttggtactctgaatctcatccctgttctattgcatttctgtgtgtttgcttctatttgtttctgggttttcaatttggggtgttatctgttcttccccagtgtgtgctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

13.05

Weight (kDa)

8.34

Isoelectric Point (pI)

49.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 23, 84
AfaI GTAC 1 cut(s) 244
AgsI TTSAA 3 cut(s) 112, 173, 310
AluBI AGCT 3 cut(s) 48, 115, 224
AluI AGCT 3 cut(s) 48, 115, 224
Alw26I GTCTC 2 cut(s) 35, 189
AspLEI GCGC 3 cut(s) 33, 94, 206
AsuHPI GGTGA 1 cut(s) 220
AsuNHI GCTAGC 1 cut(s) 80
BarI GAAGNNNNNNTAC 2 cut(s) 172, 204
BbsI GAAGAC 1 cut(s) 100
BccI CCATC 1 cut(s) 54
BcoDI GTCTC 2 cut(s) 35, 189
BfaI CTAG 3 cut(s) 20, 45, 81
BfmI CTRYAG 1 cut(s) 189
BfoI RGCGCY 1 cut(s) 207
BmrI ACTGGG 1 cut(s) 330
BmtI GCTAGC 1 cut(s) 84
BmuI ACTGGG 1 cut(s) 330
BpiI GAAGAC 1 cut(s) 100
BplI GAGNNNNNCTC 2 cut(s) 32, 64
BsaI GGTCTC 1 cut(s) 189
Bse1I ACTGG 1 cut(s) 336
BseGI GGATG 1 cut(s) 255
BseNI ACTGG 1 cut(s) 336
Bsh1285I CGRYCG 1 cut(s) 214
BsiEI CGRYCG 1 cut(s) 214
BsmAI GTCTC 2 cut(s) 35, 189
Bso31I GGTCTC 1 cut(s) 189
Bsp143I GATC 1 cut(s) 211
BspACI CCGC 2 cut(s) 23, 84
BspOI GCTAGC 1 cut(s) 84
BspTNI GGTCTC 1 cut(s) 189
BsrI ACTGG 1 cut(s) 336
BssMI GATC 1 cut(s) 211
Bst4CI ACNGT 1 cut(s) 193
BstC8I GCNNGC 3 cut(s) 50, 54, 82
BstDEI CTNAG 2 cut(s) 34, 95
BstF5I GGATG 1 cut(s) 255
BstH2I RGCGCY 1 cut(s) 207
BstHHI GCGC 3 cut(s) 33, 94, 206
BstKTI GATC 1 cut(s) 214
BstMAI GTCTC 2 cut(s) 35, 189
BstMBI GATC 1 cut(s) 211
BstMCI CGRYCG 1 cut(s) 214
BstSFI CTRYAG 1 cut(s) 189
BstV2I GAAGAC 1 cut(s) 100
BtsCI GGATG 1 cut(s) 255
BtsIMutI CAGTG 2 cut(s) 198, 343
Cac8I GCNNGC 3 cut(s) 50, 54, 82
CfoI GCGC 3 cut(s) 33, 94, 206
Csp6I GTAC 1 cut(s) 243
CviJI RGCY 3 cut(s) 48, 115, 224
CviKI_1 RGCY 3 cut(s) 48, 115, 224
CviQI GTAC 1 cut(s) 243
DdeI CTNAG 2 cut(s) 34, 95
DpnI GATC 1 cut(s) 213
DpnII GATC 1 cut(s) 211
Eco31I GGTCTC 1 cut(s) 189
FokI GGATG 1 cut(s) 242
FspBI CTAG 3 cut(s) 20, 45, 81
GlaI GCGC 3 cut(s) 32, 93, 205
HaeII RGCGCY 1 cut(s) 207
HhaI GCGC 3 cut(s) 33, 94, 206
Hin6I GCGC 3 cut(s) 31, 92, 204
HinP1I GCGC 3 cut(s) 31, 92, 204
HindIII AAGCTT 2 cut(s) 113, 222
HinfI GANTC 2 cut(s) 149, 250
HphI GGTGA 1 cut(s) 220
Hpy188I TCNGA 2 cut(s) 131, 249
Hpy99I CGWCG 1 cut(s) 107
HpyAV CCTTC 3 cut(s) 174, 190, 217
HpyCH4III ACNGT 1 cut(s) 193
HpyCH4V TGCA 2 cut(s) 56, 271
HpyF3I CTNAG 2 cut(s) 34, 95
HspAI GCGC 3 cut(s) 31, 92, 204
Kzo9I GATC 1 cut(s) 211
LpnPI CCDG 3 cut(s) 135, 273, 286
MaeI CTAG 3 cut(s) 20, 45, 81
MalI GATC 1 cut(s) 213
MboI GATC 1 cut(s) 211
MboII GAAGA 4 cut(s) 100, 146, 149, 322
MluCI AATT 2 cut(s) 165, 310
MnlI CCTC 1 cut(s) 229
MslI CAYNNNNRTG 1 cut(s) 276
NdeII GATC 1 cut(s) 211
NheI GCTAGC 1 cut(s) 80
PfeI GAWTC 2 cut(s) 149, 250
Ple19I CGATCG 1 cut(s) 214
PvuI CGATCG 1 cut(s) 214
RsaI GTAC 1 cut(s) 244
RsaNI GTAC 1 cut(s) 243
RseI CAYNNNNRTG 1 cut(s) 276
Sau3AI GATC 1 cut(s) 211
SetI ASST 6 cut(s) 50, 117, 185, 226, 233, 240
SfcI CTRYAG 1 cut(s) 189
SmiMI CAYNNNNRTG 1 cut(s) 276
Sse9I AATT 2 cut(s) 165, 310
SsiI CCGC 2 cut(s) 23, 84
SspMI CTAG 3 cut(s) 20, 45, 81
TaaI ACNGT 1 cut(s) 193
TaqI TCGA 1 cut(s) 210
TasI AATT 2 cut(s) 165, 310
TfiI GAWTC 2 cut(s) 149, 250
TscAI CASTG 2 cut(s) 198, 343
TspGWI ACGGA 1 cut(s) 142
TspRI CASTG 2 cut(s) 198, 343
XspI CTAG 3 cut(s) 20, 45, 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.