Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2D

Orthogroup ID

OG0006965

Physical Location & Seq

Genomic Coordinates Reverse (-)

10708884 .. 10712588

Gene Structure 3705 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2DG127800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 204 bp

ATGATGTTGCAAAAAGGAAAAGAAAAATGTTTCTATAAACCCTGCAGTATAGGATCAACTTTCACACCAAAGCTTCAGGGGAAGTTTTTGGCCACAGAAAATTTCTTTCACACATCTAAGTTCTTTGGTTTGGGCCCAAGGGAATTTCTTTCTAATCTGATGATTGCTGGACAACAATTCTATGAAGAGGATTGGTCAAAGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005886 GO:0005887 GO:0006139 GO:0006725 GO:0006807 GO:0006950 GO:0007155 GO:0007275 GO:0007596 GO:0007599 GO:0008150 GO:0008152 GO:0009056 GO:0009555 GO:0009611 GO:0009653 GO:0009791 GO:0009900 GO:0009901 GO:0009908 GO:0009987 GO:0010208 GO:0010584 GO:0010927 GO:0016020 GO:0016021 GO:0016043 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0017110 GO:0017111 GO:0019439 GO:0022414 GO:0022607 GO:0022610 GO:0030198 GO:0031224 GO:0031226 GO:0032501 GO:0032502 GO:0032504 GO:0032989 GO:0034641 GO:0034655 GO:0034656 GO:0042060 GO:0043062 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044085 GO:0044237 GO:0044238 GO:0044248 GO:0044270 GO:0044281 GO:0044282 GO:0044424 GO:0044425 GO:0044444 GO:0044459 GO:0044464 GO:0045229 GO:0046483 GO:0046700 GO:0048229 GO:0048367 GO:0048437 GO:0048438 GO:0048443 GO:0048466 GO:0048608 GO:0048609 GO:0048646 GO:0048653 GO:0048731 GO:0048827 GO:0048856 GO:0048869 GO:0050817 GO:0050878 GO:0050896 GO:0055086 GO:0061458 GO:0065007 GO:0065008 GO:0071704 GO:0071840 GO:0071944 GO:0085029 GO:0090567 GO:0099402 GO:1901360 GO:1901361 GO:1901575

KEGG Pathways

Metabolic & Signaling

ko00230 ko00240 ko05169 map00230 map00240 map05169

Pfam Domains

Protein Families

GDA1_CD39

Protein Analysis

67

Amino Acids

7.8

Weight (kDa)

9.03

Isoelectric Point (pI)

30.15

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006965)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0146011
rosa_laevigata	RLG00000010267
rosa_multiflora	Rmu_sc0022686.1_g000002
rosa_roxburghii	Rroxscaffold_1G00027380 Rroxscaffold_2G00110940 Rroxscaffold_2G00121620 Rroxscaffold_2G00143750 Rroxscaffold_3G00238040 Rroxscaffold_4G00298100 Rroxscaffold_4G00307350 Rroxscaffold_5G00337660 Rroxscaffold_5G00346680 Rroxscaffold_5G00364780 Rroxscaffold_5G00366680 Rroxscaffold_6G00406170 Rroxscaffold_7G00189440
rosa_rugosa	Rorug01G0433400 Rorug03G0172600 Rorug03G0172700 Rorug03G0368000.1
rosa_samantha	Rh1DG097800 Rh2BG125800 Rh2DG127800 Rh3BG286500 Rh5BG445000 Rh7CG204100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	61
AcoI	YGGCCR	1 cut(s)	90
AcsI	RAATTY	2 cut(s)	100, 143
AcuI	CTGAAG	1 cut(s)	59
AluBI	AGCT	1 cut(s)	73
AluI	AGCT	1 cut(s)	73
AlwI	GGATC	1 cut(s)	61
AoxI	GGCC	2 cut(s)	90, 133
ApaI	GGGCCC	1 cut(s)	137
ApoI	RAATTY	2 cut(s)	100, 143
AspS9I	GGNCC	2 cut(s)	133, 134
BaeGI	GKGCMC	1 cut(s)	137
BalI	TGGCCA	1 cut(s)	92
BanII	GRGCYC	1 cut(s)	137
BfmI	CTRYAG	1 cut(s)	43
BmgT120I	GGNCC	2 cut(s)	133, 134
BmiI	GGNNCC	1 cut(s)	135
BsaJI	CCNNGG	1 cut(s)	137
BseDI	CCNNGG	1 cut(s)	137
BseSI	GKGCMC	1 cut(s)	137
BshFI	GGCC	2 cut(s)	92, 135
BsnI	GGCC	2 cut(s)	92, 135
Bsp120I	GGGCCC	1 cut(s)	133
Bsp1286I	GDGCHC	1 cut(s)	137
Bsp143I	GATC	1 cut(s)	53
BspANI	GGCC	2 cut(s)	92, 135
BspLI	GGNNCC	1 cut(s)	135
BspMAI	CTGCAG	1 cut(s)	47
BspPI	GGATC	1 cut(s)	61
BssECI	CCNNGG	1 cut(s)	137
BssMI	GATC	1 cut(s)	53
BssT1I	CCWWGG	1 cut(s)	137
Bst6I	CTCTTC	1 cut(s)	180
BstDEI	CTNAG	1 cut(s)	117
BstKTI	GATC	1 cut(s)	56
BstMBI	GATC	1 cut(s)	53
BstSFI	CTRYAG	1 cut(s)	43
BstSLI	GKGCMC	1 cut(s)	137
BsuRI	GGCC	2 cut(s)	92, 135
Cfr13I	GGNCC	2 cut(s)	133, 134
CviJI	RGCY	3 cut(s)	73, 92, 135
CviKI_1	RGCY	3 cut(s)	73, 92, 135
DdeI	CTNAG	1 cut(s)	117
DpnI	GATC	1 cut(s)	55
DpnII	GATC	1 cut(s)	53
EaeI	YGGCCR	1 cut(s)	90
Eam1104I	CTCTTC	1 cut(s)	180
EarI	CTCTTC	1 cut(s)	180
Eco130I	CCWWGG	1 cut(s)	137
Eco24I	GRGCYC	1 cut(s)	137
Eco57I	CTGAAG	1 cut(s)	59
EcoT14I	CCWWGG	1 cut(s)	137
EcoT38I	GRGCYC	1 cut(s)	137
ErhI	CCWWGG	1 cut(s)	137
FaiI	YATR	3 cut(s)	36, 50, 183
FriOI	GRGCYC	1 cut(s)	137
HaeIII	GGCC	2 cut(s)	92, 135
HindIII	AAGCTT	1 cut(s)	71
Hpy188I	TCNGA	1 cut(s)	159
HpyCH4V	TGCA	2 cut(s)	10, 45
HpyF3I	CTNAG	1 cut(s)	117
Kzo9I	GATC	1 cut(s)	53
LpnPI	CCDG	3 cut(s)	55, 62, 153
MalI	GATC	1 cut(s)	55
MboI	GATC	1 cut(s)	53
MboII	GAAGA	1 cut(s)	197
MhlI	GDGCHC	1 cut(s)	137
MlsI	TGGCCA	1 cut(s)	92
MluCI	AATT	3 cut(s)	100, 143, 176
MluNI	TGGCCA	1 cut(s)	92
MnlI	CCTC	1 cut(s)	181
Mox20I	TGGCCA	1 cut(s)	92
MscI	TGGCCA	1 cut(s)	92
Msp20I	TGGCCA	1 cut(s)	92
NdeII	GATC	1 cut(s)	53
NlaIV	GGNNCC	1 cut(s)	135
PspN4I	GGNNCC	1 cut(s)	135
PspOMI	GGGCCC	1 cut(s)	133
PspPI	GGNCC	2 cut(s)	133, 134
PstI	CTGCAG	1 cut(s)	47
Sau3AI	GATC	1 cut(s)	53
Sau96I	GGNCC	2 cut(s)	133, 134
SduI	GDGCHC	1 cut(s)	137
SetI	ASST	1 cut(s)	75
SfcI	CTRYAG	1 cut(s)	43
SgeI	CNNG	4 cut(s)	54, 89, 150, 180
Sse9I	AATT	3 cut(s)	100, 143, 176
StyI	CCWWGG	1 cut(s)	137
TasI	AATT	3 cut(s)	100, 143, 176
TspDTI	ATGAA	1 cut(s)	198
XapI	RAATTY	2 cut(s)	100, 143

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.